Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1982 Mar 11;10(5):1625-33.
doi: 10.1093/nar/10.5.1625.

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast

F Sor, H Fukuhara

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast

F Sor et al. Nucleic Acids Res. .

Abstract

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.

PubMed Disclaimer

References

    1. J Mol Biol. 1974 Sep 5;88(1):185-203 - PubMed
    1. J Mol Biol. 1975 Nov 5;98(3):503-17 - PubMed
    1. Proc Natl Acad Sci U S A. 1975 Oct;72(10):3868-72 - PubMed
    1. Proc Natl Acad Sci U S A. 1976 Dec;73(12):4608-12 - PubMed
    1. J Mol Biol. 1977 Feb 15;110(1):53-74 - PubMed

Publication types