Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Comparative Study
. 1981 Jun 11;9(11):2535-41.
doi: 10.1093/nar/9.11.2535.

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp

Free PMC article
Comparative Study

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp

H P Agrawal et al. Nucleic Acids Res. .
Free PMC article

Abstract

A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70% homology with the DNA-derived putative sequences of human placenta and beef heart mitochondrial tRNA Asp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.

PubMed Disclaimer

References

    1. J Biol Chem. 1968 Feb 10;243(3):598-608 - PubMed
    1. Chem Biol Interact. 1972 Jan;4(2):81-9 - PubMed
    1. Biochim Biophys Acta. 1972 Jan 31;259(2):210-22 - PubMed
    1. Biochemistry. 1971 Dec 7;10(25):4752-6 - PubMed
    1. Dev Biol. 1972 Oct;29(2):139-51 - PubMed

Publication types

Associated data