Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Comparative Study
. 1982 Oct 11;10(19):6037-40.
doi: 10.1093/nar/10.19.6037.

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis

F Takaiwa, M Kusuda, N Saga, M Sugiura
Free PMC article
Comparative Study

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis

F Takaiwa et al. Nucleic Acids Res. .
Free PMC article

Abstract

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

PubMed Disclaimer

References

    1. Proc Natl Acad Sci U S A. 1967 Oct;58(4):1595-602 - PubMed
    1. Nat New Biol. 1973 Jun 13;243(128):199-200 - PubMed
    1. FEBS Lett. 1979 Jan 1;97(1):73-6 - PubMed
    1. Proc Natl Acad Sci U S A. 1979 Jan;76(1):381-5 - PubMed
    1. Gene. 1980 Jul;10(2):95-103 - PubMed

Publication types

Associated data