The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis
- PMID: 7145715
- PMCID: PMC320948
- DOI: 10.1093/nar/10.19.6037
The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis
Abstract
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
References
Publication types
MeSH terms
Substances
Associated data
- Actions
LinkOut - more resources
Full Text Sources
