Comparative Study
doi: 10.1093/nar/10.7.2257.
The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata
- PMID: 7201130
- PMCID: PMC320607
- DOI: 10.1093/nar/10.7.2257
Item in Clipboard
Comparative Study
The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata
Nucleic Acids Res.
.
Abstract
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.
Similar articles
-
The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.Nucleic Acids Res. 1982 Sep 11;10(17):5369-73. doi: 10.1093/nar/10.17.5369. Nucleic Acids Res. 1982. PMID: 6815619 Free PMC article.
-
The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.Nucleic Acids Res. 1984 Feb 10;12(3):1573-6. doi: 10.1093/nar/12.3.1573. Nucleic Acids Res. 1984. PMID: 6538332 Free PMC article.
-
Nucleotide sequences of chloroplast 5S ribosomal RNA from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata.Nucleic Acids Res. 1984 Jun 11;12(11):4621-4. doi: 10.1093/nar/12.11.4621. Nucleic Acids Res. 1984. PMID: 6739292 Free PMC article.
-
Improved preparative methods for isolation and purification of tobacco chloroplast ribosomes, ribosomal proteins, and rRNA.Methods Enzymol. 1986;118:201-12. doi: 10.1016/0076-6879(86)18074-8. Methods Enzymol. 1986. PMID: 3005802 Review. No abstract available.
-
Collection of published 5S and 5.8S RNA sequences and their precursors.Nucleic Acids Res. 1981 Jan 10;9(1):r25-42. doi: 10.1093/nar/9.1.213-a. Nucleic Acids Res. 1981. PMID: 7010308 Free PMC article. Review. No abstract available.
Cited by
-
Chloroplast ribosomes and protein synthesis.Microbiol Rev. 1994 Dec;58(4):700-54. doi: 10.1128/mr.58.4.700-754.1994. Microbiol Rev. 1994. PMID: 7854253 Free PMC article. Review.
-
The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.Nucleic Acids Res. 1982 Sep 11;10(17):5369-73. doi: 10.1093/nar/10.17.5369. Nucleic Acids Res. 1982. PMID: 6815619 Free PMC article.
-
Isolation, characterization, phosphorylation and site of synthesis of Spinacia chloroplast ribosomal proteins.Curr Genet. 1984 Feb;8(2):147-54. doi: 10.1007/BF00420227. Curr Genet. 1984. PMID: 24177589
-
Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.Nucleic Acids Res. 1983 Feb 25;11(4):961-70. doi: 10.1093/nar/11.4.961. Nucleic Acids Res. 1983. PMID: 6828382 Free PMC article.
-
Primary and secondary structures of chloroplast 4.5S rRNAs from two ferns, Marsilia quadrifolia and Osmunda regalis.Nucleic Acids Res. 1990 Sep 25;18(18):5560. doi: 10.1093/nar/18.18.5560. Nucleic Acids Res. 1990. PMID: 2129554 Free PMC article. No abstract available.
References
Publication types
MeSH terms
Substances
Associated data
- Actions
LinkOut - more resources
Full Text Sources
