Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Comparative Study
. 1982 Apr 10;10(7):2257-60.
doi: 10.1093/nar/10.7.2257.

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata

F Takaiwa, M Kusuda, M Sugiura
Comparative Study

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata

F Takaiwa et al. Nucleic Acids Res. .

Abstract

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

PubMed Disclaimer

References

    1. Proc Natl Acad Sci U S A. 1967 Oct;58(4):1595-602 - PubMed
    1. Nucleic Acids Res. 1977 Aug;4(8):2527-38 - PubMed
    1. Nature. 1977 Oct 27;269(5631):833-6 - PubMed
    1. Cell. 1978 Oct;15(2):661-70 - PubMed
    1. FEBS Lett. 1979 Jan 1;97(1):73-6 - PubMed

Publication types

Associated data