Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1981 Oct 24;9(20):5407-10.
doi: 10.1093/nar/9.20.5407.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum

H Hori, M Sawada, S Osawa, K Murao, H Ishikura

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum

H Hori et al. Nucleic Acids Res. .

Abstract

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

PubMed Disclaimer

References

    1. Nature. 1967 Aug 12;215(5102):735-6 - PubMed
    1. Nature. 1963 May 11;198:588-9 - PubMed
    1. Chromosoma. 1973;40(2):121-6 - PubMed
    1. Bacteriol Rev. 1972 Sep;36(3):263-90 - PubMed
    1. Adv Microb Physiol. 1973;10:1-80 - PubMed

Publication types

Associated data

LinkOut - more resources