doi: 10.1093/nar/8.22.5193.
Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support
- PMID: 7465412
- PMCID: PMC324294
- DOI: 10.1093/nar/8.22.5193
Item in Clipboard
Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support
Nucleic Acids Res.
.
Free PMC article
Abstract
Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.
Similar articles
-
Rapid synthesis of oligodeoxyribonucleotides. VII. Solid phase synthesis of oligodeoxyribonucleotides by a continuous flow phosphotriester method on a kieselguhr-polyamide support.Nucleic Acids Res. 1982 Oct 25;10(20):6243-54. doi: 10.1093/nar/10.20.6243. Nucleic Acids Res. 1982. PMID: 7177846 Free PMC article.
-
Rapid synthesis of oligodeoxyribonucleotides. V. Further studies in solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates.Nucleic Acids Symp Ser. 1980;(7):243-57. Nucleic Acids Symp Ser. 1980. PMID: 7255172
-
Rapid synthesis of oligodeoxyribonucleotides. IV. Improved solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates.Nucleic Acids Res. 1980 Mar 11;8(5):1081-96. doi: 10.1093/nar/8.5.1081. Nucleic Acids Res. 1980. PMID: 7443540 Free PMC article.
-
Principles and methods for the analysis and purification of synthetic deoxyribonucleotides by high-performance liquid chromatography.Mol Biotechnol. 1995 Oct;4(2):179-99. doi: 10.1007/BF02921611. Mol Biotechnol. 1995. PMID: 8556432 Review.
-
An approach to chemotherapy based on base sequence information and nucleic acid chemistry. Matagen (masking tape for gene expression).Ann N Y Acad Sci. 1987;507:220-41. doi: 10.1111/j.1749-6632.1987.tb45804.x. Ann N Y Acad Sci. 1987. PMID: 3327415 Review. No abstract available.
Cited by
-
Identification of a point mutation in the adenosine deaminase gene responsible for immunodeficiency.J Clin Invest. 1985 Aug;76(2):894-7. doi: 10.1172/JCI112050. J Clin Invest. 1985. PMID: 3839802 Free PMC article.
-
Recent developments in the chemical synthesis of polynucleotides.Nucleic Acids Res. 1982 Nov 11;10(21):6553-70. doi: 10.1093/nar/10.21.6553. Nucleic Acids Res. 1982. PMID: 6757865 Free PMC article. Review. No abstract available.
-
The isolation of cDNA clones for human apolipoprotein E and the detection of apoE RNA in hepatic and extra-hepatic tissues.EMBO J. 1983;2(12):2369-73. doi: 10.1002/j.1460-2075.1983.tb01748.x. EMBO J. 1983. PMID: 6199196 Free PMC article.
-
Solid phase synthesis of polynucleotides. VI. Further studies on polystyrene copolymers for the solid support.Nucleic Acids Res. 1982 Mar 11;10(5):1755-69. doi: 10.1093/nar/10.5.1755. Nucleic Acids Res. 1982. PMID: 7071021 Free PMC article.
-
Isolation of cDNA clones for the human complement protein factor B, a class III major histocompatibility complex gene product.Proc Natl Acad Sci U S A. 1982 Sep;79(18):5661-5. doi: 10.1073/pnas.79.18.5661. Proc Natl Acad Sci U S A. 1982. PMID: 6957884 Free PMC article.
References
MeSH terms
Substances
LinkOut - more resources
Full Text Sources
Other Literature Sources
