Escherichia coli tyrosine transfer ribonucleic acid genes. Nucleotide sequences of their promoters and of the regions adjoining C-C-A ends

Abstract

The template-dependent primer elongation method for determining DNA sequences of specific regions (e.g. Loewen, P., Sekiaya, T., and Khorana, H. G. (1974) J. Biol. Chem. 249, 217-226) has been applied to the determination of the sequences of the promoters and of the regions beyond the C-C-A ends of the tyrosine tRNA genes in Escherichia coli. The following results have been obtained. (a) The promoter of the tRNA1Tyr (su+) gene in the bacteriophage phi80psu+III (the singlet strain) and phi80psu+-III (the doublet strain) and, significantly, the promoter of the tRNA2Tyr gene in the bacteriophage lambdah80dglyTsu+36 all have the following identical sequence in the first 59 nucleotides: (see article) Transcription begins at the underlined terminal nucleotide and proceeds to the right. (b) tRNA1Tyr (su+) as present in the singlet strain phi80psu+III and the tRNA1Tyr (su-), the second gene in the doublet strain phi80psu+-III, have the following identical sequence beyond the C-C-A sequences: (5') TCACTTCAAAAGTCCTGAACT (3') (c) tRNA1Tyr (su+), the first gene in the doublet strain phi80psu+-III, has the sequence (5') TAATTCACCACAGGG (CA) (3'), and tRNA2Tyr in lambdah80dglyTsu+36 has the sequence (5') ATTTCGGCCACGCGA (TGCGG) (3') beyond the C-C-A nucleotides.