Functionally interacting telomerase RNAs in the yeast telomerase complex

Abstract

The ribonucleoprotein (RNP) enzyme telomerase from Saccharomyces cerevisiae adds telomeric DNA to chromosomal ends in short increments both in vivo and in vitro. Whether or not telomerase functions as a multimer has not been addressed previously. Here we show, first, that following polymerization, the telomerase RNP remains stably bound to its telomeric oligonucleotide reaction product. We then exploit this finding and a previously reported mutant telomerase RNA to demonstrate that, unexpectedly, the S. cerevisiae telomerase complex contains at least two functionally interacting RNA molecules that both act as templates for DNA polymerization. Here, functional telomerase contains at least two active sites.

Figure 1

S. cerevisiae telomerase exhibits single turnover kinetics. (A) Optimal alignment between the TLC1 RNA templating domain and the standard 14-nucleotide primer. (B,C) Products from in vitro telomerase reactions containing 0.1, 0.3, 1, 3, or 10 μl (∼30–3000 fm TLC1 RNA) (B, lanes 1–5) wild-type telomerase, and 0, 0.001, 0.003, 0.01, 0.03, 0.1, 0.3, or 1.0 μm primer (C, lanes 1–8. Terminal transferase labeled primer (lane M) marks the primer +1 position. (D) Products from in vitro telomerase reactions incubated for various time periods. (E) The total of the seven major reaction products in D are quantitated, in arbitrary units. (F) Products from a 2-min reaction (lane 1) followed by an additional 28-min incubation with (lane 2) or without (lane 3) excess unlabeled dTTP.

Figure 2

Telomerase remains stably bound to its primer substrate following polymerization. (A–C) Products from an in vitro telomerase reaction were separated on Sephacryl S-300, and aliquots of each fraction were counted in a scintillation counter (A) before being either separated on a 15% acrylamide/8 m urea gel (B), or a 3% acrylamide/0.6% agarose native gel (C) and exposed to film. (D) The gel in C was transferred to nytran, hybridized to a labeled TLC1 DNA probe, and exposed to film ∼30-fold shorter than in C. Lane numbers correspond to fraction numbers. The arrows in C and D align with each other and mark the position of the telomerase RNP. (E) Either the first third (lane 1) or all (lanes 2–4) of the telomerase containing Sephacryl S-300 fractions were pooled, UV irradiated, and separated on 9% SDS-PAGE. Control reactions were incubated with RNase A prior to (lane 3), or proteinase K following (lane 4), UV irradiation. The arrow marks an ∼103-kD cross-linked protein.

Figure 3

Formation of a stable enzyme–product complex prevents the use of a challenge primer and is not solely dependent on template–substrate base-pairing. (A–E) Products from in vitro telomerase reactions initiated with one primer (primer 0′, top box), with a second primer added halfway through the reaction (primer 7′, bottom box). Arrows mark the positions of primer +1 reaction products. Unless indicated otherwise (B), all reactions contained dNTPs throughout the reaction. Primers used are 14 (GTGTGGTGTGTGGG), 29 (GGGTGTGGTGTGTGGGTGTGGTGTGTGGG), 14–478 (GTGTGGTGTGCACG), 14–480 (GTGTGGTGCACGGG), 14* (GTGTGGTGTGTGCA), NT (TAAATTAAACAAACT), and 5′ NT (GACCGCGGTGTGTGGG).

Figure 4

Telomerase is active as a dimer. (A) Model of dimeric (left) or monomeric (right) telomerase in the presence of 5′-biotinylated (top) and nonbiotinylated (bottom) primers. (B) TLC1 RNA content (arbitrary units) of telomerase separated on a 25% (fraction 93) to 45% (fraction 1) glycerol gradient. Arrows indicate positions of thyroglobulin (698 kD), ferritin (418 kD), catalase (206 kD), and aldolase (167 kD). (C) Products from in vitro telomerase reactions (lanes 1–3) were incubated with streptavidin and separated into unbound (lanes 4–6) and bound (lanes 7–9) fractions. Primers used are 14 (GTGTGGTGTGTGGG) and B42 (GGGTGTGGTGTGTGGGTGTGGTGTGTGGGTGTGGTGTGTGGG, biotinylated at the 5′ end). Arrows indicate primer +1 products.

Figure 5

476GUG telomerase is only active as a 476GUG/WT heterodimer. (A) Model of 476GUG/WT (wild type) heterodimeric (top) or 476GUG/476GUG homodimeric (bottom) telomerase in the presence of biotinylated and nonbiotinylated primers. (B) Products from in vitro telomerase reactions were incubated with the indicated primers, bound to streptavidin, washed, and eluted. Primers used are either mutant specific (B40*, GTGTGGTGTGTGGGTGTGGTGTGTGGGTGTGGTGTGTGCA, biotinylated at the 5′ end, or 14*, GTGTGGTGTGTGCA), or wild-type-specific (14, GTGTGGTGTGTGGG). Arrows indicate primer +1 products. Control reactions containing only a single primer show that binding to streptavidin is dependent on the presence of biotin (cf. lanes 1 and 4 with biotinylated primers with lanes 2 and 5 with nonbiotinylated primers). (C) Telomerase prepared from TLC1 haploids, tlc1–476GUG haploids, or TLC1/tlc1–476GUG diploids was separated, along with a 1:1 mixture of the two haploid enzyme preparations, on a 3% acrylamide/0.6% agarose native gel, transferred to nytran, and hybridized to a labeled TLC1 DNA probe.

Figure 6

Model of dimeric yeast telomerase bound to two telomeric substrates. The two telomeric substrates have both been partially extended by the two active sites in a single telomerase RNP. Stable association of the enzyme complex with the telomeric substrates is mediated both by Watson–Crick interactions between the telomeric DNA and template RNA and by interactions between the telomeric DNA and a second primer binding site (open spaces containing primers) in the RNP. The extent of the single-stranded telomeric 3′ overhang, shown here as ∼25 nucleotides, is not known.