Regulation of transforming growth factor alpha expression in a growth factor-independent cell line

Abstract

Aberrant transcriptional regulation of transforming growth factor alpha (TGF alpha) appears to be an important contributor to the malignant phenotype and the growth factor independence with which malignancy is frequently associated. However, little is known about the molecular mechanisms responsible for dysregulation of TGF alpha expression in the malignant phenotype. In this paper, we report on TGF alpha promoter regulation in the highly malignant growth factor-independent cell line HCT116. The HCT116 cell line expresses TGF alpha and the epidermal growth factor receptor (EGFR) but is not growth inhibited by antibodies to EGFR or TGF alpha. However, constitutive expression of TGF alpha antisense RNA in the HCT116 cell line resulted in the isolation of clones with markedly reduced TGF alpha mRNA and which were dependent on exogenous growth factors for proliferation. We hypothesized that if TGF alpha autocrine activation is the major stimulator of TGF alpha expression in this cell line, TGF alpha promoter activity should be reduced in the antisense TGF alpha clones in the absence of exogenous growth factor. This was the case. Moreover, transcriptional activation of the TGF alpha promoter was restored in an antisense-TGF alpha-mRNA-expressing clone which had reverted to a growth factor-independent phenotype. Using this model system, we were able to identify a 25-bp element within the TGF alpha promoter which conferred TGF alpha autoregulation to the TGF alpha promoter in the HCT116 cell line. In the TGF alpha-antisense-RNA-expressing clones, this element was activated by exogenous EGF. This 25-bp sequence contained no consensus sequences of known transcription factors so that the TGF alpha or EGF regulatory element within this 25-bp sequence represents a unique element. Further characterization of this 25-bp DNA sequence by deletion analysis revealed that regulation of TGF alpha promoter activity by this sequence is complex, as both repressors and activators bind in this region, but the overall expression of the activators is pivotal in determining the level of response to EGF or TGF alpha stimulation. The specific nuclear proteins binding to this region are also regulated in an autocrine-TGF alpha-dependent fashion and by exogenous EGF in EGF-deprived TGF alpha antisense clone 33. This regulation is identical to that seen in the growth factor-dependent cell line FET, which requires exogenous EGF for optimal growth. Moreover, the time response of the stimulation of trans-acting factor binding by EGF suggests that the effect is directly due to growth factor and not mediated by changes in growth state. We conclude that this element appears to represent the major positive regulator of TGF alpha expression in the growth factor-independent HCT116 cell line and may represent the major site of transcriptional dysregulation of TGF alpha promoter activity in the growth factor-independent phenotype.

FIG. 1

Northern blot of TGFα RNA in clone U and revertant clone UX. Total RNAs from clone U (lane 1), UX (lane 3), and the NEO control (lane 2) were analyzed by Northern blotting for TGFα mRNA. The TGFα cDNA probe was labelled by random priming, and so endogenous (sense) TGFα mRNA and antisense TGFα RNA are both detected on the same blot.

FIG. 2

Effect of EGF treatment on TGFα expression in TGFα-antisense-RNA-transfected cells. HCT116 and TGFα-antisense-RNA-transfected cells (HCT116-33) were changed to serum-free medium minus EGF. After 48 h, cells were treated with EGF (10 ng/ml) for 4 h and RNA was isolated. Total RNA (40 μg) was analyzed by RNase protection assay for TGFα mRNA. An actin probe was used to normalize for loading.

FIG. 3

TGFα promoter activity in TGFα-antisense-RNA-expressing clone U. The p201-, p370-, and p1564-CAT constructs were transiently transfected into clone U and NEO-transfected control cells. At 12 h following transfection, cells were switched to serum-free medium minus EGF, and 48 h later, cells were harvested for CAT assay.

FIG. 4

TGFα promoter activity in revertant-phenotype clone UX. The p201- and p343-CAT constructs were transiently transfected into clone UX, a TGFα-antisense-mRNA-expressing clone which had reverted to a growth factor-independent phenotype. These same vectors were also transfected into NEO control cells. At 12 h following transfection, cells were switched to serum-free medium minus EGF, and 48 h later, the cells were harvested for CAT assay.

FIG. 5

Localization of the TGFα autoregulatory element within the TGFα promoter. (A) The TGFα promoter-TK heterologous constructs pBL-1/2-tk-CAT (containing −247 to −225 of the TGFα promoter) and pBL-3/4-tk-CAT (containing −225 to −199 of the TGFα promoter) and the control vector pBLCAT2 were transiently transfected into TGFα antisense clone U. At 12 h, half the transfected cells were switched to serum-free medium minus EGF (−), the rest being maintained in EGF-containing medium (+). Cells were harvested for CAT assay 48 h later. (B) CAT activities of the pBL-1/2-tk-CAT and pBL-3/4-tk-CAT constructs in TGFα-revertant-phenotype clone UX and NEO-transfected control cells. CAT activities were again measured in the presence (+) and absence (−) of EGF.

FIG. 6

Further characterization of the 25-bp TGFα autoregulatory element. (A) Sequence of the TGFα autoregulatory element. The sequence −201 to −225 in the parental p247-CAT vector is underlined. Underneath, the boxed sequences represent the bases which were deleted from the p247-CAT plasmid to generate the various Ex-Site PCR deletion constructs. (B) CAT activities of the Ex-Site PCR deletion plasmids in the HCT116 cell line. The plasmids illustrated in panel A were transiently transfected into HCT116 cells maintained in the absence of EGF. Cells were harvested for the CAT assay 48 h after transfection. (C) Quantitation of the CAT activities of the Ex-Site PCR deletion plasmids in HCT116 cells. The scan activity of the parental p247-CAT vector was normalized to 1. The data are presented as means ± standard errors of the means (n = 3).

FIG. 7

Characterization of the effect of TGFα autoregulatory element deletions on heterologous-promoter activity. Oligonucleotide 3/4, sequence GTGGCGAGGAGGTGACGGTAGCCGC; the TGAC deletion oligonucleotide, sequence GTGGCGAGGAGGGTAGCCGC; the TAGC deletion oligonucleotide, sequence GTGGCGAGGAGGTGACGG; and the GAGG deletion oligonucleotide, sequence GTGGCGTGACGGTAGCCGC were synthesized, hybridized, and cloned just upstream of the pAML₆₅ promoter as described in Materials and Methods. (A) CAT activities of the oligonucleotide deletion constructs in the HCT116 cell line; (B) quantitation of the CAT activities of the oligonucleotide deletion constructs in the HCT116 cell line. The activity of the native TGFα autoregulatory element represented by oligonucleotide 3/4 (the p-3/4-AML₆₅-CAT plasmid) was normalized to 1. Data are presented as means ± standard errors of the means (n = 4). (C) CAT activities of oligonucleotide 3/4 and the GAGGAG deletion construct in TGFα-antisense-mRNA-expressing clone 33; (D) graphical presentation of the activities of the deletion and heterologous-promoter constructs in clone 33. Again, the CAT activity of the p3/4-AML₆₅-CAT plasmid was normalized to 1. Scan data are presented as means ± standard errors of the means (n = 4). 3/4, oligonucleotide 3/4; del, deletion; HCT116-33, HCT116 cells with clone 33.

FIG. 8

Gel shift assay with the TGFα autoregulatory element. (A) Gel shift analysis of complexes formed with the TGFα autoregulatory element (oligonucleotide 3/4 [3/4]) and the GAGG, TAGC, and TGAC deletions (del) of this element. Equivalent amounts of nuclear extract protein (3 μg) from HCT116 control cells and TGFα antisense clone 33 were run against the various ³²P-labelled oligonucleotides. 0P denotes the lanes containing probe run without protein; Ω33 denotes the lanes containing probe run with clone 33. (B) Gel shift analysis of complexes formed with control oligonucleotide 5/6. Equivalent amounts of nuclear extract protein (3 μg) from control HCT116 cells and TGFα antisense cells were run against ³²P-labelled oligonucleotide 5/6, which contains −201 to −176 of the TGFα promoter sequence. This sequence does not participate in EGF or TGFα regulation and does not confer EGF or TGFα responsiveness to a heterologous-promoter construct. (C) Specificity of nuclear protein binding to the TGFα autoregulatory element. Nuclear extract (3 μg protein) was run against ³²P-labelled oligonucleotide 3/4 in the presence (10 ng) or absence (0 ng) of cold competing oligonucleotide 3/4 (Cold 3/4). (D) Effect of exogenous EGF on nuclear protein binding in TGFα antisense clone 33. Equivalent amounts of nuclear extract protein from TGFα antisense clone 33 cells maintained without EGF or treated with EGF (10 ng/ml) for 1 or 4 h prior to harvest were run against the ³²P-labelled TGFα autoregulatory element (oligonucleotide 3/4) or the GAGG, TAGC, and TGAC deletion oligonucleotides described in the legend to Fig. 7. 0h, 1h, and 4h denote the durations of EGF treatment.

FIG. 9

Effect of exogenous EGF on TGFα regulation in growth factor-dependent cells and effect of EGF and cycloheximide on TGFα mRNA expression. (A) Growth factor-dependent FET cells maintained in the absence of EGF were treated with EGF (10 ng/ml) or cycloheximide (10 μg/ml) for 4 h prior to harvest. Total RNA was prepared and used in a RNase protection assay as described in Materials and Methods. Control, no EGF treatment; EGF, 4 h of EGF treatment; CHX, 4 h of cycloheximide treatment; EGF+HEX, 4 h of treatment with EGF and cycloheximide. (B) Gel shift of effect of EGF on nuclear protein binding to the TGFα autoregulatory element in FET cells. FET cells were maintained in serum-free medium minus EGF. Some cells were treated with EGF (10 ng/ml) for 1 or 4 h (lane 1h or 4h, respectively) prior to harvest. These nuclear extracts were run in a gel shift assay with the TGFα autoregulatory element (oligonucleotide 3/4) as the probe. Lane 0P, probe without protein.