Relationships among the O-antigen gene clusters of Salmonella enterica groups B, D1, D2, and D3

Abstract

The O antigen is an important cell wall antigen of gram-negative bacteria, and the genes responsible for its biosynthesis are located in a gene cluster. We have cloned and sequenced the DNA segment unique to the O-antigen gene cluster of Salmonella enterica group D3. This segment includes a novel O-antigen polymerase gene (wzyD3). The polymerase gives alpha(1-->6) linkages but has no detectable sequence similarity to that of group D2, which confers the same linkage. We find the remnant of a D3-like wzy gene in the O-antigen gene clusters of groups D1 and B and suggest that this is the original wzy gene of these O-antigen gene clusters.

FIG. 1

(A) Structures of the O antigens of S. enterica groups B, D1, D1 carrying phage P27, D2, D3, and E1. Abbreviations: Abe, abequose; Gal, galactose; Man, mannose; Rha, rhamnose; Tyv, tyvelose. O-antigen epitopes are also shown. (B) Proposed epitopes of O antigen of S. enterica serovar Zuerich group D3. The bold outline around the oligosaccharide unit symbolizes the importance of the sugars in the structure of the epitopes; the thicker the line, the greater the participation of the sugars in the combining site. Dotted lines indicate that the additional sugars may weakly participate in the expression of the epitopes (modified after Nghiem et al. [28]).

FIG. 2

Central regions of the O-antigen gene clusters of S. enterica groups D1, D2, D3, and B. N, O, U, and V indicate genes wbaN, -O, -U and -V, respectively. Mannose, rhamnose (transferase only shown), DDH, and wzx genes are indicated by shading. Heavy bars above and below indicate transferase genes. Level of shading indicates degree of amino acid identity to homologous gene of group D1. Note that wbaO has barely detectable amino acid identity to wbaU. The wbaV-wbaU intergenic region of groups B and D1, shown to be remnant wzy genes, are indicated by a cross-out on the wzy gene. The similarities of the D3 cluster are indicated. The insert of plasmid pPR1739 is indicated, as are the binding sites for primers 365, 16, and 20, used for PCR of D3 DNA; primer 365 (TAGAATTCAAAGGGCTGGCTAGCTACA) is based on group D2 sequence (positions 314 to 332) (40), while primers 16 (GCGGTAGGCTTTAGAATA) and 20 (CTCTTGGAATCCAGAACG) are based on sequences of group B (positions 16160 to 16143 and 17238 to 17221, respectively) (13). The 5′ end of all four clusters (not shown) comprises rhamnose genes (rmlABCD) and DDH genes (ddhABCD), and the 3′ end comprises mannose genes (manBC) and the wbaP gene (not shown).

FIG. 3

Identification of the wzy_D3 gene by analysis of the LPS on a sodium dodecyl sulfate–12.5% polyacrylamide gel and silver staining. Lane 1, LV386 (S. enterica LT2 wzy mutant); lane 2, LV386/pPR1739; lane 3, SL1854 (LT2 wild type).

FIG. 4

DNA sequence alignment of the second half of the wzy_D3 gene and the intergenic regions of groups D1 and B. Numbering of the group D3 gene starts from the beginning of the gene; numberings of group D1 and group B sequences are from references and , respectively. Asterisks indicate the overlap of the stop codon of the wzy gene and the start codon of the wbaU gene. Strike-through and italic sections of the hypothetical wzy_B gene are alternate alignments of one sequence displayed twice to indicate similarity to two segments of wzy_D3 which may represent the basis for deletion by homologous recombination.