Sequence-specific binding of human immunodeficiency virus type 1 nucleocapsid protein to short oligonucleotides

Abstract

We have analyzed the binding of recombinant human immunodeficiency virus type 1 nucleocapsid protein (NC) to very short oligonucleotides by using surface plasmon resonance (SPR) technology. Our experiments, which were conducted at a moderate salt concentration (0.15 M NaCl), showed that NC binds more stably to runs of d(G) than to other DNA homopolymers. However, it exhibits far more stable binding with the alternating base sequence d(TG)n than with any homopolymeric oligodeoxyribonucleotide; thus, it shows a strong sequence preference under our experimental conditions. We found that the minimum length of an alternating d(TG) sequence required for stable binding was five nucleotides. Stable binding to the tetranucleotide d(TG)2 was observed only under conditions where two tetranucleotide molecules were held in close spatial proximity. The stable, sequence-specific binding to d(TG)n required that both zinc fingers be present, each in its proper position in the NC protein, and was quite salt resistant, indicating a large hydrophobic contribution to the binding. Limited tests with RNA oligonucleotides indicated that the preferential sequence-specific binding observed with DNA also occurs with RNA. Evidence was also obtained that NC can bind to nucleic acid molecules in at least two distinct modes. The biological significance of the specific binding we have detected is not known; it may reflect the specificity with which the parent Gag polyprotein packages genomic RNA or may relate to the functions of NC after cleavage of the polyprotein, including its role as a nucleic acid chaperone.

FIG. 1

Binding of NC to single- and double-stranded DNA. (A) A chip containing 312 RU of biotinylated, immobilized 28-base single-stranded DNA (i.e., GACTTGTGGAAAATCTCTAGCAGTGCAT) was exposed successively to 5, 10, 25, 50, 100, and 200 nM NC solutions. In each cycle, buffer was applied to the chip for the first 160 s. This was followed by the NC solution, which was applied for the next 160 s (the washon phase). The NC solution was followed by SPR buffer, which was allowed to flow past the chip for 700 s (the washout phase). Finally, all NC was removed with SDS (not shown). The successive binding curves are all superimposed in the figure. The horizontal line shows the RU expected if one NC molecule bound to each oligonucleotide molecule. (B) A chip containing 441 RU of biotinylated 28-base-pair double-stranded DNA was tested with the same NC concentration series as that used for panel A.

FIG. 2

Binding of NC to oligonucleotides representing different regions of the 28-base oligonucleotide tested in Fig. 1. (A) A chip containing 286 RU of GACTTGTGG (site I) was tested with 5, 10, 20, 30, 40, 60, 80, 120, 160, 200, and 250 nM NC solutions. (B) A chip containing 358 RU of AAAATCTCTA (site II) was tested with 5, 10, 20, 40, 80, 160, and 200 nM NC solutions. (C) A chip containing 297 RU of GCAGTGCAT (site III) was tested as described for panel B.

FIG. 3

Binding of NC to homopolymeric oligodeoxynucleotides. (A) A chip containing 422 RU of d(G)₉ was tested with 5, 10, 20, 40, 80, 160, and 200 nM NC solutions. (B) A chip containing 348 RU of d(T)₈ was tested as described for panel A.

FIG. 4

Significance of TGTG in site I. A chip containing 348 RU of AAAATGTGAA (A) or 296 RU of GACTAAAAGA (B) was tested as described for Fig. 3. These sequences are derived from site I by replacement of selected bases by A’s; an additional A is also present at the 3′ ends of these oligonucleotides.

FIG. 5

Stable binding of NC to pentanucleotides. SPR chips were prepared with streptavidin alone (A), or with 11.4 RU of (TG)₄ (B), 9.8 RU of TGTGT (C), or 16.8 RU of GTGTG (D). These chips contained 0, 0.08, 0.2, and 0.11 mol of oligonucleotide per mol of streptavidin, respectively. The chips were then tested with 10, 25, 50, 100, 200, and 400 nM NC solutions (A and B) or with 10, 25, 50, 200, and 400 nM NC solutions (C and D). (Because of the extremely low levels of oligonucleotide on the chips in this experiment, a relatively large amount of NC bound in the nonsaturable mode. Thus, as noted in the Discussion section, the amplitude of binding during the washon does not reflect the affinity or stoichiometry of the high-affinity, saturable mode of binding of NC to an oligonucleotide.

FIG. 6

Binding of NC to SPR channels with different densities of TGTG. For each channel, the amount of streptavidin was measured by SPR analysis before the addition of TGTG. The amount of TGTG added to each channel was then quantitated by SPR. The ratio of TGTG to streptavidin was thus empirically determined for each channel: the four channels contained 0.09, 0.71, 1.12, or 2.62 mol of TGTG per mol of streptavidin. The chips were then tested with 10, 20, 40, 80, 160, and 200 nM NC solutions. The inset in each panel is a histogram showing the fraction of streptavidin molecules occupied by zero, one, two, three, or four TGTG molecules, as predicted from the ratio (shown above each panel) of moles of TGTG to moles of streptavidin by using the binomial expansion. The horizontal line in each panel is the RU expected if one NC molecule were to bind to each streptavidin molecule with two or three TGTG molecules and if two NC molecules were to bind to each streptavidin with four TGTG molecules.

FIG. 7

Binding of finger switch NC mutant proteins to site I. A chip with 286 RU of site I (GACTTGTGG) was prepared and tested with wild-type NC (A), mutant 2.1 (B), mutant 1.1 (C), and mutant 2.2 (D) (25) at 10, 50, 100, and 200 nM.

FIG. 8

Binding of NC to RNA. SPR chips were prepared with 125.1 RU of r(UG)₄ (A), 101.8 RU of r(G)₈ (B), 104.0 RU of r(U)₈ (C), or 101.6 RU of r(A)₈ (D). They were then tested with 1, 5, 10, 25, 50, 100, and 200 nM NC solutions. In this experiment, the NC solutions contained 100 mM β-mercaptoethanol and the SPR buffer contained 5 mM β-mercaptoethanol instead of DTT. Also, the flow rate in this experiment was 64 rather than 8 μl/min.