Polymerase recognition of synthetic oligodeoxyribonucleotides incorporating degenerate pyrimidine and purine bases

Abstract

A universal base that is capable of substituting for any of the four natural bases in DNA would be of great utility in both mutagenesis and recombinant DNA experiments. This paper describes the properties of oligonucleotides incorporating two degenerate bases, the pyrimidine base 6H,8H-3,4-dihydropyrimido[4,5-c][1,2]oxazin-7-one and the purine base N6-methoxy-2,6-diaminopurine, designated P and K, respectively. An equimolar mixture of the analogues P and K (called M) acts, in primers, as a universal base. The thermal stability of oligonucleotide duplexes were only slightly reduced when natural bases were replaced by P or K. Templates containing the modified bases were copied by Taq polymerase; P behaved as thymine in 60% of copying events and as cytosine in 40%, whereas K behaved as if it were guanine (13%) or adenine (87%). The dUTPase gene of Caenorhabditis elegans, which we have found to contain three nonidentical homologous repeats, was used as a model system to test the use of these bases in primers for DNA synthesis. A pair of oligodeoxyribonucleotides, each 20 residues long and containing an equimolar mixture of P and K at six positions, primed with high specificity both T7 DNA polymerase in sequencing reactions and Taq polymerase in PCRs; no nonspecific amplification was obtained on genomic DNA of C. elegans. Use of P and K can significantly reduce the complexity of degenerate oligonucleotide mixtures, and when used together, P and K can act as a universal base.

Figure 1

Anti (1a) and syn (1b) conformation of N⁴-methoxycytidine (mo⁴C), base pairing of the analogue 6H,8H-3,4-dihydropyrimido[4,5-c][1,2]oxazin-7-one (P) with adenine and with guanine, and base pairing of the analogue N⁶-methoxy-2,6-diaminopurine (K) with cytosine and thymine.

Figure 2

Template properties of the degenerate bases. An oligonucleotide template containing unnatural bases, represented by X, and the two primers used to amplify, by PCR, the template are shown at the top; two columns of sequences showing only the regions between the two primers are shown below. The top row of each column of sequences shows the relevant portion of the oligonucleotide template (underlined sequence), on the left, are the sequences of 16 clones copied from a template containing six P residues, and on the right, are those copied from a template containing six K residues.

Figure 3

(A) Diagram of the full-length cDNA encoding the deoxyuridine triphosphatase of C. elegans (GenBank accession no. U96695). The positions of 10 bp derived from the 22-bp spliced leader (SL1), the poly(A) tail (represented by AAA), and the start (ATG) and stop (TAA) codons are shown. The positions of five motifs characteristic of dUTPase genes (25), each present three times, are represented by solid boxes. (B) The nucleotide sequences encoding the amino acid motifs 3 and 5 in each of the homologous repeats of the dUTPase gene, beneath the amino acids that they encode. Third codon positions are shown in boldface type. Beneath these nucleotide sequences are shown the two series of oligonucleotides containing base analogues that were examined for their ability to prime at these positions.

Figure 4

Autoradiographs of sequencing reactions, using T7 DNA polymerase, on cDNA templates 1, 2, and 3 and each of four primers: a vector primer, Reverse (lanes 1–12), primer m3M (lanes 13–24), primer m3P (lanes 25–36), and primer m3I (lanes 37–48). Each reaction is run in the order TGCA; 10 pmol of each primer was used in the labeling reactions, except for Reverse, where 0.5 pmol was used.

Figure 5

Electrophoresis on a 2% agarose gel of PCR products amplified with 200 pmol of both m3M and m5M on various templates as follows: Lanes: 1, no template; 2, C. elegans genomic DNA; 3, genomic clone pdutR with a 30-sec extension at 72°C in each cycle; 4, genomic clone pdutR with no pause for extension at 72°C; 5, cDNA of repeat 1; 6, cDNA of repeat 2; 7, cDNA of repeat 3; 8, φX HaeIII markers.

Figure 6

Southern blotting of PCR products, shown in Fig. 5, with probes specific for each of the three amplified repeats. The sequence of the probes were as follows (5′ to 3′): Repeat 1 (probe 1), AGGTTAAGAGTTTGCCATCC; Repeat 2 (probe 2), CCGCAAGTGAATTGGAGAAT; Repeat 3 (probe 3), AAGTGGAGAGCCTTGAAGTC. Numbering of the lanes is as in Fig. 5.