Cloning of novel isoforms of the human Gli2 oncogene and their activities to enhance tax-dependent transcription of the human T-cell leukemia virus type 1 genome

Abstract

The expression of human T-cell leukemia virus type 1 (HTLV-1) is activated by interaction of a viral transactivator protein, Tax, and cellular transcription factor, CREB (cyclic AMP response element binding protein), which bind to a 21-bp enhancer in the long terminal repeats (LTR). THP (Tax-helping protein) was previously determined to enhance the transactivation by Tax protein. Here we report novel forms of the human homolog of a member of the Gli oncogene family, Gli2 (also termed Gli2/THP), an extended form of a zinc finger protein, THP, which was described previously. Four possible isoforms (hGli2 alpha, beta, gamma, and delta) are formed by combinations of two independent alternative splicings, and all the isoforms could bind to a DNA motif, TRE2S, in the LTR. The longer isoforms, alpha and beta, were abundantly expressed in various cell lines including HTLV-1-infected T-cell lines. Fusion proteins of the hGli2 isoforms with the DNA-binding domain of Gal4 activated transcription when the reporter contained a Gal4-binding site and one copy of the 21-bp sequence, to which CREB binds. This activation was observed only in the presence of Tax. The 21-bp sequence in the reporter was also essential for the activation. These results suggest that simultaneous binding of hGli2 and CREB to the respective sites in the reporter seems to be critical for Tax protein to activate transcription. Consequently, it is probable that the LTR can be regulated by two independent signals through hGli2 and CREB, since the LTR contains the 21-bp and TRE2S sequences in the vicinity.

FIG. 1

Construction of full-sized cDNAs of the hGli2 isoforms. Thick lines represent cDNA sequences, and boxes represent open reading frames. Solid and shaded regions in the boxes are the zinc finger motifs and amino acid sequences alternatively translated from different frames, respectively. Full-sized cDNA isoforms of hGli2 were derived from overlapping sequences of THP-1 and -2 previously reported (30) and clones 2 to 6 isolated in the present study.

FIG. 2

(A) Nucleotide and amino acid sequence of hGli2α. The sequence between the solid triangles is deleted in β and δ isoforms by alternative splicing, and that between the open triangles is deleted in the γ and δ isoforms. (B) The second splicing induced a frameshift in translation, and the altered amino acid sequence is shown. The underline indicates five zinc finger motifs, and arrows with a, b, c, and d indicate the primers for RT-PCR.

FIG. 3

Sequence comparison of hGli2 α with mGli2. Sequences around possible splicing sites are compared. The numbers with the arrowheads indicate the positions in hGli2α and mGli2 (14), respectively, and * indicates identical nucleotides. The sequence between the arrows in the top panel was deleted in the hGli2 β and γ isoforms, and that in the lower panel was deleted in the hGli2 γ and δ isoforms.

FIG. 4

Binding of the hGli2 isoforms to the TRE2S DNA sequence and of the endogenous proteins in HTLV-1-infected cells. Expression vectors, pCG-hGli2 α (lanes 2 and 5) and γ (lanes 3 and 6), were separately transfected into 293T cells, and the nuclear extracts were incubated with TRE2S DNA (lanes 1 to 3) or TRE2M, an inactive mutant (lanes 4 to 6), which were labeled with biotin. The DNA-protein complexes were isolated with avidin beads and analyzed by Western blotting with antiserum against hGli2. A nuclear extract from Hut102 cells, an HTLV-1-infected T-cell line, was also analyzed similarly (lanes 1 and 4). TRE2S, CCGGGAAGCCACCGGGAACCACCCA; TRE2M, CCGGGAAGCCACCGGGAACAAATTA.

FIG. 5

Expression of hGli2 isoforms at the mRNA and protein levels. (A) Northern blot of poly(A)⁺ RNA from Hut102 (lane 1), FL (lane 2), and HeLa (lane 3) cells with the coding sequence of hGli2 α as a probe. A HindIII digest of λ phage DNA is shown as a molecular size marker (lane 4). (B) Detection of the endogenous Gli2 isoforms expressed in Hut102 cells. Total RNA of Hut102 cells was used as the template for reverse transcription with random primers, and the cDNA sequences obtained were amplified with two sets of primers, A and B (lane 1) or C and D (lane 4), which encompass each splicing site (Fig. 1 and 2). As the standards, hGli2 α (lanes 2 and 5), β (lane 3) and γ (lane 6) were also amplified with the same primers. Fragments of 179 and 128 bp are from RNA without and with splicing at the first site, respectively, and fragments of 1,487 and 256 bp are those from RNA without and with splicing at the second site, respectively. (C) Identification of protein isoforms of hGli2 in Hut102 cells by Western blot analysis. Lanes: 1 and 2, whole-cell extract; 3, nuclear fraction; 4, cytoplasmic fraction; 5, hGli2 α; 6, hGli2 γ. Antiserum against hGli2 was used for lanes 1 and 3 to 6, and preimmune serum was used for lane 2.

FIG. 6

Dose-dependent activation of CAT expression by pCG-Gal4-hGli2 α. The reporter plasmid, pGal4-21bp-CAT, contained the Gal4 binding site and one copy of the 21-bp sequence. The assay was carried out similarly to that described for Table 1.