Methylation status of CpG sites and methyl-CpG binding proteins are involved in the promoter regulation of the mouse Xist gene

Abstract

The mouse Xist gene is expressed exclusively from the inactive X chromosome and is involved in the initiation of X inactivation. We previously reported that the -1157/+917 region of the Xist promoter was ubiquitously functional in mammalian cells and that experiments in a transient expression system revealed no trans-acting element responsible for the inactive X specific expression of Xist. In somatic tissues, the 5' end of the silent Xist allele on the active X is known to be fully methylated whereas the expressed allele on the inactive X is unmethylated. In the present study we have used a bisulphite genomic sequencing method to evaluate DNA methylation at all cytosines including CpG dinucleotides within the Xist promoter. We report and confirm that methylation of specific sites plays a key role in Xist gene expression. In vitro DNA methylation of the 5'-region drastically reduced transcriptional activity in transiently transfected fibroblasts. Mobility shift assays showed that methylation does not inhibit Xist promoter activity by preventing the binding of transcription factors and that two distinct nuclear proteins bind in a sequence methyl-CpG-specific manner. Therefore, we suggest that Xist repression involves its promoter methylation and two distinct methylated DNA binding proteins.

FIG. 1

Methylation status of the Xist promoter studied by bisulphite genomic sequencing. (A) CpG methylation in the −357 to +52 Xist region. Cytosines of underlined CpG remain unmodified after bisulphite reaction in most of the 14 analyzed clones. Number of clones in which corresponding cytosine is not modified by the treatment is indicated above the sequence. The arrow indicates the transcription initiation site and the black circles show the CpG sites accessible to methyl-sensitive restriction enzymes. (B) Genomic sequence profile of a cloned PCR product following sodium bisulphite conversion of Xist promoter (−60 to +20). Methylated CpG cytosines retained as cytosines are indicated by closed circles and unmethylated cytosines converted to thymines are shown by open circles.

FIG. 2

Reverse transcriptase PCR demonstrates transcriptional activation of the Xist gene after treatment with 5-azacytidine. The BLK/CL.4 cells were treated with increasing concentrations of 5-azacytidine. Forty-eight or 72 h after treatment, RNA was extracted and RT-PCR amplification was performed with primers designed to amplify the Xist transcript (Xist-F: GGGACCTAACTGTTGGCTTTATCAG and Xist-R: GAAGTGAATTGAAGTTTTGGTCTAG), with or without reverse transcriptase to exclude DNA contamination. The products of RT-PCR were electrophoresed on a 8% polyacrylamide gel. The transcription analysis of Insr, a constitutively active gene, serves as a positive control (Insr-F: ACCTGCTTCTCTTCCGTGTCTATGG and Insr-R: CCCACATCCCTCGTTGTCATCTTTG).

FIG. 3

Xist promoter activity is inhibited by DNA methylation and the extent of this repression is independent on the density of methyl-CpG. BALB/3T3 cells were transfected with either unmethylated or SssI-methylated constructs using DOTAP. Relative CAT activities compared with that of each unmethylated construct are presented. Three different Xist promoter regions were analyzed and compared with both PGK-1 and SV40 promoters, which had been previously shown to be sensitive and insensitive, respectively, to methylation. The arrow indicates the main cap site (+1) and the vertical bars indicate the methylated CpG sites. All the plasmids have in common the CAT sequence and are flanked by an A + T-rich sequence together with the SV40 enhancer (black box).

FIG. 4

DNA binding of Metl, a methylated DNA binding protein, to the −57/−33 region. Labeled unmethylated and methylated GMSA17 oligonucleotides (−57/−33: CTCTCCGCCTTCAGCGCCGCGGATC) were used for EMSA without or with BALB/3T3 nuclear extracts. The reaction mixture for competition experiments contained unlabeled nonmethylated GMSA17 (m-), nonmethylated GMSA1B (m-), mutant GMSA1K, and methylated GMSA1B (m+).

FIG. 5

Mutation of the −52, −43, −40, −38, −23, −16 CpG sites into TpG were introduced into the −132 to +20 CAT construct and promoter activity was tested by CAT assay in female cell line after methylation. The white squares indicate the unmethylated CpG sites, the black squares are the methylated CpG and the T letters correspond to the mutated CpG sites into TpGs.

FIG. 6

DNA binding of Met2, a second methylated DNA binding protein distinct of Metl. Labeled unmethylated and methylated GMSA19 oligonucleotide (GCTCCAGCCATGTTTGCTCGTTTCCCGTGGATGTGC) was used for EMSA without or with BALB/3T3 nuclear extracts. The reaction mixture for competition experiments contained unlabeled nonmethylated GMSA19 (m-), methylated GMSA19 (m+), methylated GMSA17 (m+), heterologous methylated competitor ED89 (m+), and heterologous nonmethylated competitor 4RMUT (m-). A nonspecific protein-DNA complex migrates more slowly than the Met2-DNA complex.