Novel regulatory factors interacting with the promoter of the gene encoding the mRNA cap binding protein (eIF4E) and their function in growth regulation

Abstract

Regulation of the mRNA cap binding protein (eIF4E) is critical to the control of cellular proliferation since this protein is the rate-limiting factor in translation initiation and transforms fibroblasts and since eIF4E mutants arrest budding yeast in the G1 phase of the cell cycle (cdc33). We previously demonstrated regulation of eIF4E by altered transcription of its mRNA in serum-stimulated fibroblasts and in response to c-myc. To identify additional factors regulating eIF4E transcription, we used linker-scanning constructs to characterize sites in the promoter of the eIF4E gene required for its expression. Promoter activity was dependent on sites at -5, -25, -45, and -75; the site at -75 included a previously described myc box. Electrophoretic mobility shift assays identified DNA-protein interactions at -25 and revealed a binding site (TTACCCCCCCTT) that is unique to the eIF4E promoter. Proteins of 68 and 97 kDa bound this site in UV cross-linking and Southwestern experiments. Levels of 4E regulatory factor activities correlated with c-Myc levels, eIF4E expression levels, and protein synthesis in differentiating U937 and HL60 cells, suggesting that these activities may function to regulate protein synthesis rates during differentiation. Since the eIF4E promoter lacked typical TATA and initiator elements, further studies of this novel initiator-homologous element should provide insights into mechanisms of transcription initiation and growth regulation.

FIG. 1

Oligonucleotides used in the EMSA experiments.

FIG. 2

Identification of sites within the eIF4E promoter necessary for promoter activity. (Top) General scheme of linker-scanning mutations. (Bottom) The indicated eIF4E-CAT linker-scanner constructs were transfected into HeLa cells and analyzed for CAT activity. The effect of the mutation on CAT expression compared with that of the unaltered eIF4E-CAT construct is presented as the mean and standard error. The mean and standard error are based on three transfections, each performed in duplicate (n = 6 for each determination).

FIG. 3

Comparison of sequences from the mouse and human eIF4E promoter. The sequences of the mouse and human promoter regions extending 5′ to the PstI site used to make peIF4E-CAT are compared. The mouse and human promoters are markedly similar in the regions of the human promoter used in these studies. MB1 and MB2 identify the two myc boxes previously identified in this promoter (35). Exon 1 is shaded. The CCAAT box and the three linker sites critical to promoter functions are boxed and indicated.

FIG. 4

EMSA experiments identify a unique protein binding region within the eIF4E proximal promoter sequences. (A) LS1 through LS5 digested with MscI and XhoI generated a series of insertions across the promoter. These oligonucleotides and the corresponding sequences from unaltered eIF4E-CAT were radiolabeled and analyzed by standard EMSA. The indicated cold competitor oligonucleotide (1000× Cold) contained the wild-type eIF4E oligonucleotide to evaluate specificity. The sites where linker sequences replace endogenous sequence are written in lowercase and are underlined for emphasis throughout this figure. (B) LS2 through LS7 were digested with XbaI and XhoI, generating a series of 5′ deletion mutants. These oligonucleotides were radiolabeled and EMSAs were performed as above. The indicated cold competitor oligonucleotide (1000× Cold) contained the wild-type eIF4E oligonucleotide. (C) LS1 through LS5 were digested with MscI and XbaI, generating a series of 3′ deletion mutants. These oligonucleotides and the corresponding sequences from unaltered eIF4E-CAT were radiolabeled and EMSAs were performed as above. The indicated cold competitor oligonucleotide (1000× Cold) contained wild-type eIF4E.

FIG. 5

A core 12-nucleotide element is sufficient for binding activity. (A) A series of LS3 oligonucleotides was generated in which every 3 nucleotides were sequentially replaced by GGG. The indicated oligonucleotides were analyzed by EMSA. Cold competitor oligonucleotides contained the same sequences as the probes to demonstrate specificity. (B) Another series of mutant LS3 oligonucleotides was generated in which deletions of three nucleotides were made sequentially from both ends. The indicated oligonucleotides were analyzed by EMSA. Cold competitor oligonucleotides contained the same sequences as the probes.

FIG. 6

Core binding activity at the eIF4E binding site differs from known initiator elements in cross-competition experiments. (A) Core binding seen at a unique binding site in the eIF4E promoter is modified by interactions at flanking sites. The LS543 oligonucleotide and the LS3 oligonucleotide were directly radiolabeled. LS4 and eIF4E-CAT were digested with XbaI and XhoI and radiolabeled. The resulting oligonucleotides were subjected to EMSA as described in the text. Cold competitor oligonucleotide (row 100×) was included to demonstrate specificity. Lines in the schematic below the gel show what portion of the whole region between −59 and +3 is included in each of the indicated oligonucleotides. (B) Core binding activity at the eIF4E binding site differs from known initiator elements. The LS5 and LS3 oligonucleotides were directly radiolabeled. LS2 and LS6 were digested with XbaI and XhoI and radiolabeled. The resulting oligonucleotides were subjected to EMSA as described above. Cold competitor oligonucleotides (row 1000×) were used to determine specificity (see Fig. 1 for identification of competitors).

FIG. 7

Novel 97- and 68-kDa proteins bind the LS3 site in UV cross-linking experiments. (A) A trimeric form of the LS3 oligonucleotide, AAGGGGGGGTAAGAGGAAGAAGGGGGGGTAAGAGGAAGAAGGGGGGGTAAGAGGAAACTCTAGACT, was primed with AGTCTAGAGT and labeled with 5-bromo-2′-dUTP and [α-³²P]dCTP, and an excess of cold dGTP and dATP. A full length, double-stranded, trimeric probe containing all 66 bp was purified by polyacrylamide gel electrophoresis. This oligonucleotide (lane tri) was analyzed by EMSA as described above (Fig. 4). The cold competitor oligonucleotides used to demonstrate specificity included TATA (lane IID), the LS3 monomer (lane LS3), the LS3-7, LS3-8, and LS3-9 mutant oligonucleotides, the initiator region binding sites in the adenovirus major late promoter (lane MLP), the initiator region of the terminal deoxynucleotidyltransferase promoter (lane TDT), the Yin-Yang 1 (lane YY1) binding site, and unrelated NF-1 and SP-1 sites. (B) The full-length, double stranded LS3 trimer oligonucleotide was radiolabeled with 5-bromo-2′-dUTP and [α-³²P]dCTP along with cold dATP and dGTP in standard Klenow reactions. The 66-bp probe was then incubated with 25 μg of nuclear lysates from HeLa cells as described in Materials and Methods. Each reaction mixture was irradiated with a UV transilluminator for a period experimentally determined to optimize cross-linking. After incubation with DNase I, the samples were analyzed on a 10% denaturing polyacrylamide gel. The indicated cold competitor oligonucleotides were used to demonstrate specificity (see Fig. 1 for identification of competitors). Size markers are indicated (SM).

FIG. 8

Levels of LS3-interacting proteins correlate with c-Myc in fibroblast cell lines. (A) Nuclear extracts (50 μg) from HeLa (lane He), REF-myc (lane RM), and REF-neo (lane RN) cells blotted on nitrocellulose filters were renatured through guanidine hydrochloride and then hybridized in Southwestern binding buffer containing the α-³²P-labeled LS3 trimer oligonucleotide probe. c-Myc levels decrease from 90,000 copies of c-Myc protein in HeLa cells (49) to 30% of that level in REF-myc cells and 10% in REF-neo cells (35). Size markers (lane SM) are indicated. (B) Binding of the α-³²P-labeled LS3 trimeric probe to REF-myc and REF-neo nuclear extracts (10 μg) was compared in EMSA experiments. Binding conditions were identical to those used for experiments in previous figures. The indicated amounts of cold-competitor oligonucleotides (LS3 and SP1) were added in the designated lanes to evaluate the specificity of binding. A trimeric version of mutant oligonucleotide LS3-8 (mut) is included in lanes 4 and 9.

FIG. 9

Decreased eIF4E expression during myeloid differentiation correlates with decreased levels of the 4E regulatory factors, c-Myc and protein synthesis. (A and B) For Southwestern analyses, protein lysates from U937 (A) and HL60 (B) cells were prepared with Laemmli buffer at 0, 3, 6, 24, 48, and 72 h after the addition of TPA. The lysates (50 μg) at the indicated time points were analyzed with the radioactively labeled LS3 trimer oligonucleotide in a Southwestern assay (SW panels). Size markers (lane SM) are indicated. For Northern blots, total cellular RNA was harvested from U937 (second through fourth panels in panel A) and HL60 (second through fourth panels in panel B) cells after the addition of TPA. RNA was size fractionated, run on formaldehyde-agarose gels, blotted, and hybridized with eIF4E, c-myc, or GAPDH plasmid fragments (4E, myc, and GAPDH, respectively). The protein lysates used for the Southwestern analyses were additionally run on 10% denaturing polyacrylamide gels, blotted, and probed with anti-eIF4E, anti-c-Myc, and anti-actin antibodies for the U937 (fifth through seventh panels [4E, myc, and actin] in panel A) and HL60 (fifth through seventh panels [4E, myc, and actin] in panel B) cells. (C through F) U937 (C and E) and HL60 (D and F) cells were pulse-labeled for 3 h with [³⁵S]methionine and [³H]thymidine at the indicated time points. Aliquots of protein lysates at each time point were harvested directly in Laemmli buffer and run on 10% denaturing polyacrylamide gels to simultaneously evaluate protein synthesis rates of multiple individual proteins (C and D). Counts incorporated during pulse labeling were further evaluated by trichloroacetic acid precipitation of cell lysates (E and F). [³⁵S]methionine (solid bars; y axis on right) and [³H]thymidine (open bars; y axis on left) incorporation is displayed as the mean and standard deviation of four determinations at each time point to evaluate the regulation of net protein synthesis (³⁵S) and DNA synthesis (³H) during differentiation.

FIG. 10

The polypyrimidine element in eIF4E is related to other initiator regions but contains significant differences. (A) Sequence is conserved at polypyrimidine (pPy) element 3 between mouse and human sequences. This sequence is further compared with the consensus sequence for an initiator region and for the YY1 element. Underlining indicates nucleotides required for YY1 binding which differ in the eIF4E element. Shaded boxes indicate nucleotides normally required for initiator binding which differ in the eIF4E element. (B) Model for potential direct and indirect effects of c-myc on the eIF4E promoter. c-myc may activate the eIF4E promoter by directly interacting with either or both of its myc boxes (LS8 and LS23). Alternatively, c-myc may indirectly regulate eIF4E through regulation of proteins binding at the LS3 site.