Developmentally programmed assembly of higher order telomerase complexes with distinct biochemical and structural properties

Abstract

In Euplotes crassus, telomerase is responsible for telomere maintenance during vegetative growth and de novo telomere synthesis during macronuclear development. Here we show that telomerase in the vegetative stage of the life cycle exists as a 280-kD complex that can add telomeric repeats only onto telomeric DNA primers. Following the initiation of macronuclear development, telomerase assembles into larger complexes of 550 kD, 1600 kD, and 5 MD. In the 1600-kDa and 5-MDa complexes, telomerase is more processive than in the two smaller complexes and can add telomeres de novo onto nontelomeric 3' ends. Assembly of higher order telomerase complexes is accompanied by an extended region of RNase V1 and RNase T1 protection in the telomerase RNA subunit that is not observed with telomerase from vegetatively growing cells. The protected residues encompass a highly conserved region previously proposed to serve as a platform for formation of higher order structures. These findings provide the first direct demonstration of developmentally regulated higher order telomerase complexes with unique biochemical and structural properties.

Figure 1

Telomerase from vegetative macronuclei elutes as a 280-kD complex and a high molecular weight complex in gel filtration. S100 macronuclear lysates from vegetatively growing E. crassus were fractionated by gel filtration chromatography on a superose 6 column. Fractions were assayed with (G₄T₄)₃. The positions of a 5′ ³²P-labeled 12-mer recovery control (RC) and a terminal transferase 3′³²P-labeled 22 nucleotide marker are indicated. (Lane 1) S100; (lanes 2–24) even numbered fractions of the column elution profile. Elution positions of molecular weight standards are indicated. The high molecular mass products in lane 1 are the result of extension of contaminating DNA in the lysate and are not the result of processive extension of the primer (data not shown).

Figure 2

Telomerase from developing macronuclei assembles into higher order complexes. S100 macronuclear lysates from E. crassus undergoing macronuclear development were fractionated by gel filtration chromatography as described in Fig. 1. Assays and molecular weight markers are as in Fig. 1. (Lane (1) Macronuclei; (lane 2) S100; (lanes 3–26) even-numbered fractions from the column elution profile. G3, 11, and 19 correspond to synthesis of the third, eleventh, and nineteenth dG, respectively, in the G₄T₄ repeated ladder. The peaks corresponding to distinctive telomerase complexes are indicated.

Figure 3

Distinct forms of telomerase are present in developing macronuclei. Individual telomerase complexes fractionated from developing macronuclear lysates were concentrated by dialysis into 40% PEG, rechromatographed by gel filtration and assayed for telomerase activity. Rechromatographed 550-kD (Fig. 2, fractions 16–18) (A) and 1600-kD (Fig. 2, fractions 12–14) (B) complexes are shown. (Lanes 1) Reactions with a macronuclear lysate; (lane 2) reactions with the isolated, concentrated telomerase peaks (see Materials and Methods) prior to rechromatography; (lanes 3–26) superose 6 column elution profile. Assays and molecular mass markers are as in Fig. 1.

Figure 3

Distinct forms of telomerase are present in developing macronuclei. Individual telomerase complexes fractionated from developing macronuclear lysates were concentrated by dialysis into 40% PEG, rechromatographed by gel filtration and assayed for telomerase activity. Rechromatographed 550-kD (Fig. 2, fractions 16–18) (A) and 1600-kD (Fig. 2, fractions 12–14) (B) complexes are shown. (Lanes 1) Reactions with a macronuclear lysate; (lane 2) reactions with the isolated, concentrated telomerase peaks (see Materials and Methods) prior to rechromatography; (lanes 3–26) superose 6 column elution profile. Assays and molecular mass markers are as in Fig. 1.

Figure 4

Individual telomerase complexes show unique biochemical properties with respect to primer utilization and processivity. Telomerase complexes fractionated by gel filtration were assayed with (G₄T₄)₃ or the chimeric primer GT-13 (GGGGTTTTACTACGCGATCAT). (Lanes 1,2) Reactions with 280-kD vegetative complex; (lanes 3,4) 550-kD developmental complex; (lanes 5,6) 1600-kD developmental complex; (lanes 7,8) the developmental 5-MD complex. The migration position of the fourth T and/or third G residue in the TTTTGGGG elongation profile are indicated (T16 and G19). (*)The band in the 280-kD preparation is not primer dependent and does not copurify further with telomerase activity. An overexposure of 550-kD complex assays is shown to emphasize the lack of processive products.

Figure 5

Accessibility of the telomerase RNA in intact macronuclei is developmentally regulated. (A) Footprinting reactions with RNase V1. (Lanes 1,6) Extension reactions without prior ribonuclease treatment; (lanes 5,9) (labeled stop) reaction termination controls (see Materials and Methods); (lanes 2–4) 5-, 10-, and 15-min RNase V1 footprint reactions, respectively, with developing macronuclei; (lanes 7,8) 5- and 10-min RNase V1 footprint reactions with vegetative macronuclei. Cleavage sites are indicated with arrowheads and sequencing ladders used to map the sites of ribonuclease accessibility are denoted. (B) Footprinting reactions with RNase T1. Control lanes and sequencing markers are labeled as in A. (Lanes 2–4,6–8) 5-, 10-, and 15-min reactions with RNase T1; (lane 9) stop reaction. Predominant cleavage sites are indicated with arrowheads. The RNase T1 cleavage site at position 122 in the vegetative macronuclei is near a nonspecific band at nucleotide 125. The background level of damage at this site varied from experiment to experiment and PhosphorImager analysis confirmed the increased intensity of this band in the presence of RNase T1 (data not shown), ruling out the possibility that it is solely the result of nonspecific RNA damage. (C) Ribonuclease cleavage sites superimposed on the phylogentically predicted structure of the E. crassus telomerase RNA (Shippen-Lentz and Blackburn 1990; Lingner et al. 1994). Conserved nucleotides 112–120 are shown in larger, boldface type and a potential thermodynamically stable helix corresponding to nucleotides 10–25 is depicted. Nucleotides 36–50 comprise the templating domain. RNase V1 cleavage sites, black arrowheads, and RNase T1 sensitive sites, gray arrowheads, are indicated.

Figure 5

Accessibility of the telomerase RNA in intact macronuclei is developmentally regulated. (A) Footprinting reactions with RNase V1. (Lanes 1,6) Extension reactions without prior ribonuclease treatment; (lanes 5,9) (labeled stop) reaction termination controls (see Materials and Methods); (lanes 2–4) 5-, 10-, and 15-min RNase V1 footprint reactions, respectively, with developing macronuclei; (lanes 7,8) 5- and 10-min RNase V1 footprint reactions with vegetative macronuclei. Cleavage sites are indicated with arrowheads and sequencing ladders used to map the sites of ribonuclease accessibility are denoted. (B) Footprinting reactions with RNase T1. Control lanes and sequencing markers are labeled as in A. (Lanes 2–4,6–8) 5-, 10-, and 15-min reactions with RNase T1; (lane 9) stop reaction. Predominant cleavage sites are indicated with arrowheads. The RNase T1 cleavage site at position 122 in the vegetative macronuclei is near a nonspecific band at nucleotide 125. The background level of damage at this site varied from experiment to experiment and PhosphorImager analysis confirmed the increased intensity of this band in the presence of RNase T1 (data not shown), ruling out the possibility that it is solely the result of nonspecific RNA damage. (C) Ribonuclease cleavage sites superimposed on the phylogentically predicted structure of the E. crassus telomerase RNA (Shippen-Lentz and Blackburn 1990; Lingner et al. 1994). Conserved nucleotides 112–120 are shown in larger, boldface type and a potential thermodynamically stable helix corresponding to nucleotides 10–25 is depicted. Nucleotides 36–50 comprise the templating domain. RNase V1 cleavage sites, black arrowheads, and RNase T1 sensitive sites, gray arrowheads, are indicated.

Figure 5

Accessibility of the telomerase RNA in intact macronuclei is developmentally regulated. (A) Footprinting reactions with RNase V1. (Lanes 1,6) Extension reactions without prior ribonuclease treatment; (lanes 5,9) (labeled stop) reaction termination controls (see Materials and Methods); (lanes 2–4) 5-, 10-, and 15-min RNase V1 footprint reactions, respectively, with developing macronuclei; (lanes 7,8) 5- and 10-min RNase V1 footprint reactions with vegetative macronuclei. Cleavage sites are indicated with arrowheads and sequencing ladders used to map the sites of ribonuclease accessibility are denoted. (B) Footprinting reactions with RNase T1. Control lanes and sequencing markers are labeled as in A. (Lanes 2–4,6–8) 5-, 10-, and 15-min reactions with RNase T1; (lane 9) stop reaction. Predominant cleavage sites are indicated with arrowheads. The RNase T1 cleavage site at position 122 in the vegetative macronuclei is near a nonspecific band at nucleotide 125. The background level of damage at this site varied from experiment to experiment and PhosphorImager analysis confirmed the increased intensity of this band in the presence of RNase T1 (data not shown), ruling out the possibility that it is solely the result of nonspecific RNA damage. (C) Ribonuclease cleavage sites superimposed on the phylogentically predicted structure of the E. crassus telomerase RNA (Shippen-Lentz and Blackburn 1990; Lingner et al. 1994). Conserved nucleotides 112–120 are shown in larger, boldface type and a potential thermodynamically stable helix corresponding to nucleotides 10–25 is depicted. Nucleotides 36–50 comprise the templating domain. RNase V1 cleavage sites, black arrowheads, and RNase T1 sensitive sites, gray arrowheads, are indicated.

Figure 6

Ribonuclease protection in isolated telomerase complexes. Isolated telomerase complexes were footprinted separately as in Fig. 5. RNase V1 footprints of the 280-(A), 550- (B), and 1600-kD (C) complexes are shown. Lane designations are as in Fig. 5. The position of nucleotide 109 is indicated with an arrowhead. For each panel, equivalent amounts of sequencing ladder were loaded and the exposures were adjusted until the signals of full-length RNA were approximately the same.