Interaction of a nascent RNA structure with RNA polymerase is required for hairpin-dependent transcriptional pausing but not for transcript release

Abstract

Nascent RNA structures may regulate RNA chain elongation either directly through interaction with RNA polymerase or indirectly by disrupting nascent RNA contacts with polymerase or DNA. To distinguish these mechanisms we tested whether the effects of the his leader pause RNA hairpin could be mimicked by pairing of antisense DNA or RNA oligonucleotides to the nascent transcript. The his pause hairpin inhibits nucleotide addition when it forms 11 nucleotides from the transcript 3' end. It also can terminate transcription when base changes extend its stem to </=8 nucleotides from the 3' end. All oligonucleotides that disrupted the pause hairpin reduced the dwell time of RNA polymerase at the pause site dramatically, even when they mimicked the 11-nucleotide 3'-proximal RNA spacing or created a suitably positioned RNA loop. Oligonucleotides that paired </=8 nucleotides from the pause RNA 3' end could trigger transcript release, but only when added to an already paused complex. These results argue that direct interaction of a nascent RNA hairpin with RNA polymerase delays escape from a pause, but that indirect effects of a hairpin may trigger transcript release from a paused complex. Resistance of the paused complex to pyrophosphorolysis and its reversal by antisense oligonucleotides further suggest that interaction of the pause hairpin with RNA polymerase disengages the RNA 3' end from the active site.

Figure 1

Possible effects of antisense oligonucleotides on hairpin-dependent pausing. (Top) The mechanism of hairpin-dependent transcriptional pausing. The four components of the his pause signal are labeled on the paused TC, which is formed in competition with bypass of the site and then slowly escapes back into the elongation pathway. How the pause hairpin inhibits nucleotide addition is unknown, but it presumably disrupts reactive alignment of the RNA 3′OH and incoming NTP (depicted here by separation of the 3′ OH and NTP-binding subsites, i and i + 1; see Fig. 7). (Bottom) In the direct model of hairpin-dependent pausing, a specific interaction between the RNA hairpin and its binding site on RNAP disrupts nucleotide addition in the active site of RNAP (Chan et al. 1997; Wang and Landick 1997). In the indirect model, the hairpin merely defines a particular length of 3′-proximal, single-stranded RNA transcript and thus could both disrupt RNA–RNAP interactions required for elongation or TC stability and prevent backtracking of RNAP along the DNA template (Komissarova and Kashlev 1997b; Nudler et al. 1997). Annealing of antisense oligonucleotides to the nascent RNA would be able to recapitulate indirect effects of hairpins, but not direct effects.

Figure 2

Effect of DNA oligonucleotides on the his pause half-life. (A) Preformed [α³²P]CTP-labeled A29 complexes were chased with 10 μm GTP, 150 μm ATP, CTP, UTP in the presence (left) or absence (right) of the −15 oligonucleotide. Samples were taken at the times (in sec) indicated above each lane. The chase lanes contain samples that were incubated for an additional 5 min with 250 μm each NTP after completion of the time course. (P) Pause RNA transcript; (RO) run-off RNA transcript. Nonlinear regression yielded pseudo-first order half-lives of 5 and 60 sec for the −15-oligonucleotide and no oligonucleotide experiments, respectively (see Materials and Methods). (B) Pause half-lives were plotted (as a fraction of a ‘no oligo’ control from the same experiment) by the 5-most nucleotide of the nascent RNA that remains outside the RNA–oligonucleotide duplex (equivalent to the length of nascent RNA between the RNA–oligonucleotide duplex and the nascent RNA 3′ end). Each value is an average of at least two independent measurements.

Figure 2

Effect of DNA oligonucleotides on the his pause half-life. (A) Preformed [α³²P]CTP-labeled A29 complexes were chased with 10 μm GTP, 150 μm ATP, CTP, UTP in the presence (left) or absence (right) of the −15 oligonucleotide. Samples were taken at the times (in sec) indicated above each lane. The chase lanes contain samples that were incubated for an additional 5 min with 250 μm each NTP after completion of the time course. (P) Pause RNA transcript; (RO) run-off RNA transcript. Nonlinear regression yielded pseudo-first order half-lives of 5 and 60 sec for the −15-oligonucleotide and no oligonucleotide experiments, respectively (see Materials and Methods). (B) Pause half-lives were plotted (as a fraction of a ‘no oligo’ control from the same experiment) by the 5-most nucleotide of the nascent RNA that remains outside the RNA–oligonucleotide duplex (equivalent to the length of nascent RNA between the RNA–oligonucleotide duplex and the nascent RNA 3′ end). Each value is an average of at least two independent measurements.

Figure 3

Transcript release by antisense oligonucleotides. (A) A29 complexes or preformed paused complexes were eluted from the beads (see Materials and Methods) and incubated for 5 min in the presence of either the −10 or −7 oligonucleotide. Elongation was allowed to resume in the presence of 1 m KCl by addition of NTPs and samples were taken at the times indicated above each lane. (B) Preformed paused complexes were left on beads, incubated with 500-fold excess of each oligonucleotide in 1 m KCl, and chased with NTPs. The supernatants (released RNA) and the beads (RNA remaining in TCs) from samples before and after the chase were collected and electrophoresed separately. (C) Relative concentrations of pause RNA that was extended (shaded bars) released from TCs (solid bars), or retained on beads (open bars) after addition of NTPs to the preformed paused complexes were determined from PhosphorImager scans and are plotted as a fraction of the total pause RNA.

Figure 3

Transcript release by antisense oligonucleotides. (A) A29 complexes or preformed paused complexes were eluted from the beads (see Materials and Methods) and incubated for 5 min in the presence of either the −10 or −7 oligonucleotide. Elongation was allowed to resume in the presence of 1 m KCl by addition of NTPs and samples were taken at the times indicated above each lane. (B) Preformed paused complexes were left on beads, incubated with 500-fold excess of each oligonucleotide in 1 m KCl, and chased with NTPs. The supernatants (released RNA) and the beads (RNA remaining in TCs) from samples before and after the chase were collected and electrophoresed separately. (C) Relative concentrations of pause RNA that was extended (shaded bars) released from TCs (solid bars), or retained on beads (open bars) after addition of NTPs to the preformed paused complexes were determined from PhosphorImager scans and are plotted as a fraction of the total pause RNA.

Figure 4

Effect of RNA oligonucleotides on pausing on the wild-type (WT; A) and multisubstituted (MS; B) hairpin templates. A29 complexes were walked to the −7 (U64) position, incubated in the presence or absence of oligonucleotide, and then chased (see Materials and Methods). RNA1 is complementary to the WT pause hairpin (CCUGAAAGACUAGUCAGGAUGA), RNA2 oligonucleotide is complementary to the MS hairpin and contains the 7-nucleotide insertion of the trp hairpin loop sequence (underlined; CCUGACUAAUGAAAGACUAGUUAAUAUGA); for both RNA1 and RNA2 oligonucleotides the 5′ end is positioned at −11. RNA3 oligonucleotide corresponds to the his pause hairpin (CCUGACUAGUCUUUCAGG). Structures predicted to form with annealing of oligonucleotides to the RNA transcript are shown schematically above each lane. Calculated pause half-lives are indicated below each panel.

Figure 5

Effect of DNA oligonucleotides on pausing on templates with hairpins destabilized by ITP substitution within the stem or KCl addition. A29 complexes were walked to the −11 (G60) position (A,B) or to the pause site (U71, C). Either GTP (A) or ITP (B) was incorporated at three positions within the hairpin stem (see Fig. 1). Complexes were eluted from the beads and incubated at 37°C for 5 min in the absence or presence of oligonucleotide −15, and, in C, at 1 m KCl. Elongation was resumed and samples were analyzed as above. Half-lives determined as described in Materials and Methods are shown below each panel.

Figure 6

Transcript sensitivity to pyrophosphorolysis. (Top) Different conformations of TC can be distinguished by their sensitivity to transcript cleavage and pyrophosphorolysis. (Bottom) Immobilized TCs were halted along the template encoding the WT his pause signal at the positions indicated below each panel and treated with increasing concentrations of PP_i (indicated above each panel; see Materials and Methods). Oligonucleotides, 1 m KCl, or both were added when indicated.

Figure 7

Model of events that interrupt RNA chain elongation and the effects of antisense oligonucleotides on them. The steps in rapid chain elongation (see text) are represented horizontally at the top. RNAP in an elongating TC is represented by the oval; the DNA strands were omitted for clarity. RNAP’s bipartite active site is represented by the double circle (modified from Erie et al. 1992 to use i for the binding site of the 3′-terminal nucleotide and i + 1 for the binding site of the incoming NTP). Transcript bases that are paired to the DNA template are shown by vertical lines; other transcript bases are not shown (the RNA-to-DNA hybrid is thought to be ∼8 bp; see Lee and Landick 1992; Landick 1997; Nudler et al. 1997, and references therein). This model of hairpin-dependent pausing and ρ-independent termination differs superficially from other versions we have published recently (Chan et al. 1997; Landick 1997; Mooney et al. 1998) because it shows the backtracked pause as a separate intermediate to illustrate the possibility that, at least for some ρ-independent terminators, RNAP–RNA hairpin interaction may not be essential for transcript release.