Legionella pneumophila catalase-peroxidases: cloning of the katB gene and studies of KatB function

Abstract

Legionella pneumophila, the causative organism of Legionnaires' pneumonia, is spread by aerosolization from man-made reservoirs, e.g. , water cooling towers and air conditioning ducts, whose nutrient-poor conditions are conducive to entrance into stationary phase. Exposure to starvation conditions is known to induce several virulence traits in L. pneumophila. Since catalase-peroxidases have been extremely useful markers of the stationary-phase response in many bacterial species and may be an avenue for identifying virulence genes in L. pneumophila, an investigation of these enzymes was initiated. L. pneumophila was shown to contain two bifunctional catalase-peroxidases and to lack monofunctional catalase and peroxidase. The gene encoding the KatB catalase-peroxidase was cloned and sequenced, and lacZ fusion and null mutant strains were constructed. Null mutants in katB are delayed in the infection and lysis of cultured macrophage-like cell lines. KatB is similar to the KatG catalase-peroxidase of Escherichia coli in its 20-fold induction during exponential growth and in playing a role in resistance to hydrogen peroxide. Analysis of the changes in katB expression and in the total catalase and peroxidase activity during growth indicates that the 8- to 10-fold induction of peroxidase activity that occurs in stationary phase is attributable to KatA, the second L. pneumophila catalase-peroxidase.

FIG. 1

Restriction map of L. pneumophila katB region. The thick horizontal line depicts the region sequenced (3,865 nt). Every nucleotide reported was identified in two to five sequencing runs, each with a different sequencing primer. Beneath the line are indicated the locations of the 5′ (TGATGCAGGCCTGCAGTTCACCAGTCAGCAGAGCG) and 3′ (GGTTTACAAAGCTTAGATGAGACTTACAGAAACG) PCR primers (5′-PCR and 3′-PCR) and the site of insertion of the ΩCm cassette (ΩCm). The underlined regions are PstI and HindIII sites, respectively, that replaced 6 nt in the genomic L. pneumophila sequence. The arrow indicates the direction of transcription and the position of the katB open reading frame.

FIG. 2

Conserved active site residues in bacterial catalase-peroxidases. The asterisks mark the conserved residues that are homologous to residues of known function in yeast CCP. L. pneumophila KatB (a), E. coli KatG; (b), R. capsulatus (c), M. tuberculosis ATCC 25618 (d), and B. stearothermophilus (e) sequences are shown. (A) Distal side of heme. Residues marked by asterisks correspond to those forming the binding site for peroxide in CCP (R-48, W-51, and H-52 in the CCP sequence). (B) Proximal side of heme. Residues marked by asterisks correspond to CCP residues which form the fifth coordination position of the heme (H-175) and a site of hydrogen bonding to a heme propionate (H-181).

FIG. 3

Zymogram analysis for catalatic and peroxidatic activities. Cell extracts of overnight AYE cultures (500 μg of protein per lane) were electrophoresed under nondenaturing conditions, and the gel was stained to visualize catalatic (A) or diaminobenzidine-peroxidase activity (B). The two catalase-peroxidases in L. pneumophila are indicated. Lanes 1, strain JR32 (wild type); lanes 2, strain PB117 katB::ΩCm (katB null).

FIG. 4

Growth of L. pneumophila in cultured macrophage cells. Adherent THP-1 cells (3 × 10⁵ per well) were infected on day 0 with 1 × 10³ to 5 × 10³ cells of the wild-type strain JR32 (•) or the katB null strain PB117 (■) from overnight cultures in AYE medium. Error bars indicate standard deviations.

FIG. 5

Expression of catalatic and peroxidatic activities during growth. (A) Growth stage induction of the katB::lacZ fusion in the chromosomal fusion strain PB102. (B) Catalatic and dianisidine peroxidase specific activities of wild-type strain JR32 in mid-exponential and stationary phases and activity ratio (below abscissa). Error bars indicate standard deviations. OD₆₀₀, optical density at 600 nm.