Poly(A) tail length control in Saccharomyces cerevisiae occurs by message-specific deadenylation

Abstract

We report that newly synthesized mRNA poly(A) tails are matured to precise lengths by the Pab1p-dependent poly(A) nuclease (PAN) of Saccharomyces cerevisiae. These results provide evidence for an initial phase of mRNA deadenylation that is required for poly(A) tail length control. In RNA 3'-end processing extracts lacking PAN, transcripts are polyadenylated to lengths exceeding 200 nucleotides. By contrast, in extracts containing PAN, transcripts were produced with the expected wild-type poly(A) tail lengths of 60 to 80 nucleotides. The role for PAN in poly(A) tail length control in vivo was confirmed by the finding that mRNAs are produced with longer poly(A) tails in PAN-deficient yeast strains. Interestingly, wild-type yeast strains were found to produce transcripts which varied in their maximal poly(A) tail length, and this message-specific length control was lost in PAN-deficient strains. Our data support a model whereby mRNAs are polyadenylated by the 3'-end processing machinery with a long tail, possibly of default length, and then in a PAN-dependent manner, the poly(A) tails are rapidly matured to a message-specific length. The ability to control the length of the poly(A) tail for newly expressed mRNAs has the potential to be an important posttranscriptional regulatory step in gene expression.

FIG. 1

The PAN RNase is present in RNA 3′-end processing extracts. (A) Wild-type (WT) and Pan3p-deficient (panΔ) yeast S-100 extracts were ammonium sulfate precipitated as described in Materials and Methods. The total starting extracts (T), soluble fractions (S), and precipitatant fractions (P) were resolved by SDS-PAGE, and the indicated proteins were detected by Western blot analysis. Wild-type and Pan3p-deficient cell extracts were prepared from strains YAS306 and YAS1943, respectively. Equivalent percentages of the fractions were loaded onto the lanes. (B) Detection of PAN activity in 3′-end processing extracts prepared from pan and pab1 mutant yeast strains. One microgram of total protein was incubated with radiolabeled poly(A) and either recombinant Pab1p (black bars), pab1-55p (grey stippled bars), or no additional Pab1p (white bars) as described in Materials and Methods. Nuclease activity was measured by quantifying the release of trichloroacetic acid (TCA)-soluble [³²P]AMP (y axis). The purified PAN enzyme serves as a positive control for the Pab1p-stimulated RNase activity. The yeast strains used to prepare the 3′-end processing extracts were (from left to right) YAS306, YAS2283, YAS1943, YAS1942, YAS1254, and YAS1255. Abbreviations: recomb., recombinant; WT, wild type.

FIG. 2

pan and pab1 mutant yeast extracts polyadenylate RNA substrates to aberrantly long lengths in vitro. The six 3′-end processing extracts (10 μg of total protein) described in the legend to Fig. 1B and a wild-type extract (YAS306) immunoneutralized for Pab1p (lanes 15 and 16) were programmed with CYC1 pre-RNA as described in Materials and Methods. Reaction products were visualized on a 6% polyacrylamide gel and visualized by autoradiography. Products of the cleavage reaction only (C) or of cleavage and polyadenylation of the CYC1 pre-RNA (A) are shown. Lane 1; DNA markers (M); lane 2, input CYC1 pre-RNA (precursor [pre]). The migration positions of the 5′-upstream cleavage product and the polyadenylated products are indicated to the right, and the sizes (in nucleotides) of the DNA markers are indicated to the left. WT, wild type; α-Pab1p, anti-Pab1p.

FIG. 3

Deadenylation by the PAN RNase is required for proper poly(A) tail length control in vitro. (A) Cleavage and polyadenylation reactions were performed and visualized as described in the legend to Fig. 2. RNA 3′-end processing extracts described in the legend to Fig. 1B were incubated with (+) or without (−) purified PAN. Lane 1, DNA markers (M); lane 2, input CYC1 pre-RNA (precursor [pre]); lane 3, product of cleavage reaction only. The migration positions of the 5′-upstream cleavage product and the polyadenylated products are indicated to the right, and the sizes (in nucleotides) of the DNA markers are indicated to the left. WT, wild type. (B) Time course of CYC1 3′-end processing was carried out in either wild-type extracts of strain YAS306 (lanes 3 to 7), pan3Δ mutant extracts of YAS1943 (lanes 8 to 12), or pan3Δ mutant extracts, containing exogenously added purified PAN (lanes 13 to 21). The purified enzyme was either added at the beginning of the reaction (lanes 13 to 17) or 60 min post-CYC1 cleavage and polyadenylation (lanes 18 to 21). Cleavage and polyadenylation reactions were carried out and visualized as described in the legend to Fig. 2. Lane 1, DNA markers (M); lane 2, input CYC1 pre-RNA (precursor [pre]). The migration positions of the 5′-upstream cleavage product and the polyadenylated products are indicated to the right, and the sizes (in nucleotides) of the DNA markers are indicated to the left.

FIG. 4

Excess Pab1p reduces the severity of the pan mutant polyadenylation phenotype. (A) Western blot analysis of Pan3p and Pab1p in the previously described 3′-end processing extracts (Fig. 2). A 1.5-μg amount of total protein was loaded in each lane. WT, wild type. (B) Excess Pab1p inhibits polyadenylation in vitro. Recombinant Pab1p was added to the wild-type (YAS306 [lanes 4 to 7]) or pan2Δ pan3Δ mutant (YAS2283 [lanes 12 to 15]) extracts. Alternatively, the endogenous Pab1p was first immunoneutralized in wild-type (lanes 8 to 11) or pan mutant (lanes 16 to 19) extracts with monoclonal anti-Pab1p (α-Pab1p) antibodies (see Materials and Methods). The amount of recombinant Pab1p (in nanograms) added to each reaction mixture is indicated above the blot. Cleavage and polyadenylation reactions were performed and visualized as described in the legend to Fig. 2, except that reaction mixtures were incubated for 90 min. Lane 1, markers (M); lane 2, input CYC1 pre-RNA (precursor [pre]); lane 3, product of cleavage reaction only. The migration positions of the 5′-upstream cleavage product and the polyadenylated products are indicated to the right, and the sizes (in nucleotides) of the DNA markers are indicated to the left.

FIG. 4

Excess Pab1p reduces the severity of the pan mutant polyadenylation phenotype. (A) Western blot analysis of Pan3p and Pab1p in the previously described 3′-end processing extracts (Fig. 2). A 1.5-μg amount of total protein was loaded in each lane. WT, wild type. (B) Excess Pab1p inhibits polyadenylation in vitro. Recombinant Pab1p was added to the wild-type (YAS306 [lanes 4 to 7]) or pan2Δ pan3Δ mutant (YAS2283 [lanes 12 to 15]) extracts. Alternatively, the endogenous Pab1p was first immunoneutralized in wild-type (lanes 8 to 11) or pan mutant (lanes 16 to 19) extracts with monoclonal anti-Pab1p (α-Pab1p) antibodies (see Materials and Methods). The amount of recombinant Pab1p (in nanograms) added to each reaction mixture is indicated above the blot. Cleavage and polyadenylation reactions were performed and visualized as described in the legend to Fig. 2, except that reaction mixtures were incubated for 90 min. Lane 1, markers (M); lane 2, input CYC1 pre-RNA (precursor [pre]); lane 3, product of cleavage reaction only. The migration positions of the 5′-upstream cleavage product and the polyadenylated products are indicated to the right, and the sizes (in nucleotides) of the DNA markers are indicated to the left.

FIG. 5

Maximal mRNA poly(A) tail lengths are increased in pan and pab1 mutant yeast strains. A polyacrylamide Northern blot was hybridized with probes specific for RPL46 (top panel), PGK1 (middle panel) and MFA2 (bottom panel) mRNAs. To resolve PGK1 poly(A) tails, total RNA was first treated with RNase H in the presence of oligonucleotide ORP70 (20). The RPL46 and MFA2 mRNAs were detected with a randomly primed, labeled BamHI-SalI probe of pAS142 and a HindIII probe of pAS139, respectively. The PGK1 mRNA was detected with the end-labeled oligonucleotide OAS325 (5′ TTGATCTATCGATTTCAATTCAATTCAATTT). Lane 1, deadenylated transcript (A₀) by RNase H treatment of total RNA in the presence of oligo(dT); lane 2, wild-type (WT) yeast strain YAS306; lane 3, pan2Δ pan3Δ mutant strain YAS2283; lane 4, pan3Δ mutant yeast strain YAS1943; lane 5, pan2Δ mutant yeast strain YAS1942; lane 6, PAB1 wild-type yeast strain YAS1254; lane 7, pab1-55 mutant yeast strain YAS1255. The estimated sizes of the poly(A) tails are indicated to the left.

FIG. 6

Steady-state poly(A) tail lengths for galactose-induced mRNAs are longer in the absence of PAN. Wild-type (WT) and pan mutant yeast strains harboring the GAL1:RPL46 vector (pAS582), the GAL1:PGK1pG vector (pRP602), and the GAL1:MFA2pG vector (pRP485), were grown to early log phase in galactose-containing medium (YM with 2% galactose lacking uracil). RNA was isolated, and poly(A) tails were resolved as described in the legend to Fig. 5. The GAL1:RPL46 mRNA was detected with the end-labeled oligonucleotide OAS326 (5′ GTTTTTTCTCCTTGACGTTAAAGTATAGAGGTATATTAACAATTTTTTGTTGATAC), complementary to the GAL1 leader. PGK1pG and MFA2pG mRNAs were detected with the end-labeled oligo(C) probe, ORP121 (46). Lanes 1, deadenylated transcript (A₀) by RNase H treatment of total RNA in the presence of oligo(dT); lanes 2, wild-type (WT) yeast strains YAS2288 (GAL1:RPL46), YAS2286 (GAL1:PGK1pG), and YAS2284 (GAL1:MFA2pG); lanes 3, pan2Δ pan3Δ mutant yeast strains YAS2289 (GAL1:RPL46), YAS2287 (GAL1:PGK1pG), and YAS2285 (GAL1:MFA2pG). The estimated sizes of the poly(A) tails are indicated to the left.

FIG. 7

Transcriptional pulse of the PGK1 and MFA2 mRNAs in pan mutant and wild-type yeast strains. (A) Wild-type yeast strain YAS2286 and pan mutant yeast strain YAS2287 were pregrown in raffinose and sucrose-containing medium and then shifted to galactose (Gal)-containing medium to induce PGK1pG mRNA. Time points were taken at 0, 4, 8, and 12 min following the galactose (Gal) shift. Lanes 1 and 12, DNA markers (M) with sizes (in nucleotides) indicated to the left; lanes 2 and 7, PGK1pG mRNA treated with RNase H and oligo(dT) to remove the poly(A) tail (A₀); lanes 13 and 14, the wild-type (WT) and pan mutant PGK1pG mRNA produced after a 12-min galactose induction were electrophoresed side by side to more easily visualize poly(A) tail length differences. (B) Transcriptional pulse was carried out as described above for panel A, except MFA2pG mRNA was induced in the wild-type yeast strain YAS2284 and the pan mutant yeast strain YAS2285.

FIG. 8

Model for mRNA poly(A) tail length control in the yeast S. cerevisiae. Processing of the 3′ end of a pre-RNA begins with cleavage and polyadenylation of the substrate to a default length, ranging from 70 to 90 nucleotides. This default length may, in part, be determined by Pab1p. The PAN RNase then rapidly matures the mRNA poly(A) tail to a message-specific length, ranging from 50 to 90 nucleotides. The fully processed mRNA is then a substrate for both the translation apparatus and the mRNA degradation machinery.