Upstream A-tracts increase bacterial promoter activity through interactions with the RNA polymerase alpha subunit

Abstract

Upstream A-tracts stimulate transcription from a variety of bacterial promoters, and this has been widely attributed to direct effects of the intrinsic curvature of A-tract-containing DNA. In this work we report experiments that suggest a different mechanism for the effects of upstream A-tracts on transcription. The similarity of A-tract-containing sequences to the adenine- and thymine-rich upstream recognition elements (UP elements) found in some bacterial promoters suggested that A-tracts might increase promoter activity by interacting with the alpha subunit of RNA polymerase (RNAP). We found that an A-tract-containing sequence placed upstream of the Escherichia coli lac or rrnB P1 promoters stimulated transcription both in vivo and in vitro, and that this stimulation required the C-terminal (DNA-binding) domain of the RNAP alpha subunit. The A-tract sequence was protected by wild-type RNAP but not by alpha-mutant RNAPs in footprints. The effect of the A-tracts on transcription was not as great as that of the most active UP elements, consistent with the degree of similarity of the A-tract sequence to the UP element consensus. A-tracts functioned best when positioned close to the -35 hexamer rather than one helical turn farther upstream, similar to the positioning optimal for UP element function. We conclude that A-tracts function as UP elements, stimulating transcription by providing binding site(s) for the RNAP alphaCTD, and we suggest that these interactions could contribute to the previously described wrapping of promoter DNA around RNAP.

Figure 1

Sequences of the upstream regions of lac and rrnB P1 promoter derivatives. Promoter and upstream A-tract-containing sequences are in uppercase. Phased A-tracts are in boldface. Lowercase sequence upstream of the EcoRI cloning site (underlined) is from the phage λ vectors in the promoter-lacZ fusion constructs (see Methods). Promoter sequences downstream of the −35 hexamer (to +52 for lac derivatives or +50 for rrnB P1 derivatives) are not shown. (A) The lac core promoter contains lac sequence downstream from −47. Lac sequence from −41 to −47 does not affect promoter activity (27). Hybrid A-tract lac promoters contain an upstream phased A-tract sequence (11) and lac sequence downstream from either −39 (−40 A-tract lac) or −47 (−50- and −55-A-tract lac). (B) The rrnB P1 promoters contain either the native rrnB P1 UP element [+UP, with rrnB P1 sequence downstream from −66; (9, 20)], the nonfunctional “SUB” sequence (also lowercase) from −59 to −41 [−UP; (9)], or a phased A-tract sequence (four A-tract as in A or a shorter two A-tract sequence) and rrnB P1 sequence downstream from −39. The consensus UP element sequence (25) is shown for comparison.

Figure 2

In vitro transcription of wild-type lac or lac-hybrid promoters with (A) wild-type RNAP or (B) α-mutant RNAP (αΔ235). Duplicate samples are shown. Transcripts from the lacUV5, lac, and vector-encoded RNAI promoters are indicated with arrows. The lacUV5 transcript is ≈10 nt shorter than lac transcripts because of a different promoter downstream endpoint (+39). Plasmid templates were pRLG593 [lacUV5; (31)]; pRLG1820 [rrnB P1 (−88 to −37, Δ72)-lac(−36 to +52); (9)], pRLG1821 [lac −47 to +52; (9)], pRLG4258 (−40 A-tract-lac; Fig. 1), pRLG4260 (−50 A-tract-lac; Fig. 1), and pRLG4262 (−55-A-tract-lac; Fig. 1).

Figure 3

In vitro transcription of rrnB P1 promoter derivatives with wild-type or α-mutant (αΔ235 or R265A) RNAPs. The consensus UP element-rrnB P1 promoter contains the sequence of the 4192-UP element, 5′AAAATTTTTTTTCAAAAGTA from −57 to −38 (25). Transcripts from the RNAI and rrnB P1 promoters are indicated by arrows. Plasmid templates were pRLG2230 [−UP; rrnB P1 (−41 to +50), Fig. 1], pRLG4238 [+UP; rrnB P1 (−66 to +50), (25)], pRLG3278 [UP element 4192-rrnB P1; (25)], pRLG4268 (four A-tract-rrnB P1; Fig. 1), and pRLG4269 (two A-tract-rrnB P1; Fig. 1).

Figure 4

DNase I footprints of complexes formed by (A) the two A-tract-rrnB P1 promoter or (B) the four A-tract-rrnB P1 promoter with wild-type RNAP (10 nM) or mutant RNAP (αΔ235 or R265A; each 32 nM). Control samples lacking RNAP (0) are in lanes 3 (in A and B) and 4 (in B). Regions fully or partially protected by wild-type RNAP (WT; vertical bars) and by α-mutant RNAPs (αΔ235 or αR265A; hatched boxes) are indicated. The phased A-tract-containing regions in the two A-tract promoter (A) are labeled 1 and 2, and in the four A-tract promoter (B) are labeled 1–4, where 1 represents the promoter proximal A-tract region (see Fig. 1 for sequences). A+G and G sequence markers were prepared as described in (40). Promoter fragments were 3′-end labeled in the bottom (template) strand at a site just upstream of the A-tract regions.