Genetic and biochemical analyses of the tec operon suggest a route for evolution of chlorobenzene degradation genes

Abstract

The TecA broad-spectrum chlorobenzene dioxygenase of Burkholderia sp. strain PS12 catalyzes the first step in the mineralization of 1,2,4, 5-tetrachlorobenzene. The catabolic genes were localized on a small plasmid that belongs to the IncPbeta incompatibility group. PCR analysis of the genetic environment of the tec genes indicated high similarity to the transposon-organized catabolic tcb chlorobenzene degradation genes of Pseudomonas sp. strain P51. Sequence analysis of the regions flanking the tecA genes revealed an upstream open reading frame (ORF) with high similarity to the todF 2-hydroxy-6-oxo-2,4-heptadienoate hydrolase gene of Pseudomonas putida F1 and a discontinuous downstream ORF showing high similarity to the todE catechol 2,3-dioxygenase gene of strain F1. Both homologues in strain P51 exist only as deletion remnants. We suggest that different genetic events thus led to inactivation of the perturbing meta-cleavage enzymes in strains P51 and PS12 during the evolution of efficient chlorobenzene degradation pathways. Biochemical characterization of TodF-like protein TlpF and a genetically refunctionalized TodE-like protein, TlpE, produced in Escherichia coli provided data consistent with the proposed relationships.

FIG. 1

Southern analysis of PS12 DNA. Total DNA of 1,2,4,5-tetrachlorobenzene-grown Burkholderia sp. strain PS12 (lane PS12) was digested with BamHI (lane a), BamHI-BglII (lane b), and BglII (lane c) and electrophoretically separated on an agarose gel. The tcbAaAbAcAd dioxygenase genes (lane P51) from Pseudomonas sp. strain P51 were amplified from plasmid pTBCB60 (42) with primers prSTB1 and prSTB4 (forward, atgaatcacaccgacacctcccct [the tecA1 start codon is in boldface]; reverse, tcatgctgagtctccttgttgtgc [the tcbAd stop codon is in boldface]) and were used as a positive control. The gel was analyzed by Southern hybridization with the tecA1 gene probe of PS12 (A). Total DNAs from strain PS12 and toluenesulfonate-grown C. testosteroni T-2 (lane T-2) were subjected to PFGE, stained with ethidium bromide (B), and analyzed by Southern hybridization with the tecA1 gene probe of PS12 (C) and the IncPβ-specific trfA2 gene probe derived from plasmid R751 (D). The bracket arrow indicates the positions of the two PS12-1 plasmid species which gave signals with both probes. The positions of other plasmids are indicated by horizontal bars. The reference plasmids of strain T-2 (pTSA [85 kb, IncPβ] and pT2T [50 kb, unknown incompatibility group]) served as DNA molecular size markers and as controls for probe specificity in Southern experiments. In addition, the positions of the slots containing chromosomal (C) and nicked chromosomal (NC) DNAs are indicated. Excess blank lanes between the PS12 and T-2 samples were digitally removed with Photoshop software (Adobe).

FIG. 2

PCR analysis of the genetic environment of the tecA genes of Burkholderia sp. strain PS12. The sequence context of a previously characterized 5.5-kb genomic DNA fragment from strain PS12 (5), which is similar to the corresponding sequence of Pseudomonas sp. strain P51 (A), was analyzed by PCR (B). The PS12 sequence comprises the tecA1A2A3A4 genes encoding the tetrachlorobenzene dioxygenase, the truncated tecB gene encoding the cis-chlorobenzene dihydrodiol dehydrogenase, the truncated IS1066 homologue, the tlpF 2-hydroxy-6-oxo-2,4-heptadienoate hydrolase gene, and the inactivated tlpE* catechol 2,3-dioxygenase pseudogene (C). The primers were designed on the basis of known sequences of Pseudomonas sp. strain P51 and Burkholderia sp. strain PS12. PCR products are drawn as black boxes, whereas white boxes indicate failure to obtain a product of the expected size. The numbers and arrows below the boxes refer to prSTB primer numbers and priming direction, respectively, as follows: prSTB45, atgaaactcaaaggtgaagtg, (containing the tecB start codon); prSTB46, tcaagcgaaatgcttgtcgag (containing the tecB stop codon [boldface]); prSTB47, ctagtgtttaattcgtcatg (containing the IS1066 inverted repeat [underlined]); prSTB48, ctagtgtttaattccgtaaattg (containing the IS1066 inverted repeat [underlined] and stop codon [boldface]); prSTB49, caatttacggaattaaacaatag (containing the IS1067 inverted repeat [underlined] and stop codon [boldface]); prSTB50, gctcgacaagcatttcgcttga (containing the tecB stop codon [boldface]); prSTB51, atggaattccggcagctcaag (containing the tcbR start codon [boldface]); prSTB52, tcagtccttcgcggatcgccgc (containing the tcbR stop codon [boldface]); prSTB53, gcggcgatccgcgaaggactga (containing the tcbR stop codon [boldface]); prSTB54, gatcgccgcaatgtggttgcat (containing nucleotides −60 to −82 of the tlpF gene); prSTB55, atgaacgaacgagtgaagcagg (containing the tcbC start codon [boldface]); prSTB56, gtcagggttgcggtggctcc (containing the tcbF stop codon [boldface]); prSTB57, cctgcttcactcgttcgttcat (containing the tcbC start codon [boldface]); prSTB58, cttgagagctgccggaattccat (containing the tcbR start codon [boldface]); prSTB65, catgagcattcaaagattgggctac (containing the todE start codon [boldface]); prSTB66, gtgacctaagccctggtctccag (containing the middle region of todE); prSTB67, gtcaggcgggcgcctggaac (containing the todE stop codon [boldface]). The deduced genetic environment of the 5.5-kb fragment of strain PS12 is indicated 5′ and 3′ with respect to the previously obtained sequence. Gene names are shown above the respective ORFs, which are shown as grey arrows. Hatched boxes indicate sequences exhibiting high similarity to the meta-cleavage pathway todE and todF genes of P. putida F1.

FIG. 3

Sequence alignment and structural features of catechol 2,3-dioxygenases and nucleotide and deduced amino acid sequences of the TlpF hydrolase. (A) Alignment of extradiol dioxygenases of Burkholderia sp. strain LB400 (BphC_LB400) and P. putida F1 (TodE_F1) and the refunctionalized TlpE protein of Burkholderia sp. strain PS12 (TlpE_PS12). Based on the solved structure of the BphC enzyme, two domains (N and C terminal) with similar secondary structures can be distinguished (19), as indicated above the alignment. Identical residues are shaded. The amino acid ligands of the catalytic Fe(II) are marked (•), and those playing a direct catalytic role in the LB400 enzyme are indicated (■). Additional residues that form the substrate binding site in the LB400 enzyme are marked (▴), and conserved residues that play a structural role are indicated (□). The boxed fingerprint region contains the consensus sequence (G or N or T or I or V)-X₁-H-X_{5 or 7}-(L or I or V or M or F)-Y-X₂-(D or E or N or T or A)-P-X₁-(G or P)-X_{3 or 4}-E (14), where X_n indicates n residues of any type, parentheses enclose residues found at one position, and boldface letters indicate the residues found in the TlpE protein. The positions of relevant restriction sites of the corresponding tlpE gene are indicated. (B) The dipeptide His-Gly of the putative oxanion hole, the RVIAPDXXGXGXS motif, and the so-called hydrolase or lipase box with the nucleophile motif Gly103-Xaa-Ser105-Xaa-Xaa-Gly108 (3, 11, 12) of the TlpF hydrolase are boxed. The catalytic residues Ser105, Asp226, and His254, representing the catalytic triad of hydrolases (2, 12, 29) and lipases (8, 11), are circled and in boldface. The region proposed to be involved in determination of substrate specificity (12) is underlined. Relevant restriction sites are indicated.