Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs

Abstract

Unmethylated CpG dinucleotides in particular base contexts (CpG-S motifs) are relatively common in bacterial DNA but are rare in vertebrate DNA. B cells and monocytes have the ability to detect such CpG-S motifs that trigger innate immune defenses with production of Th1-like cytokines. Despite comparable levels of unmethylated CpG dinucleotides, DNA from serotype 12 adenovirus is immune-stimulatory, but serotype 2 is nonstimulatory and can even inhibit activation by bacterial DNA. In type 12 genomes, the distribution of CpG-flanking bases is similar to that predicted by chance. However, in type 2 adenoviral DNA the immune stimulatory CpG-S motifs are outnumbered by a 15- to 30-fold excess of CpG dinucleotides in clusters of direct repeats or with a C on the 5' side or a G on the 3' side. Synthetic oligodeoxynucleotides containing these putative neutralizing (CpG-N) motifs block immune activation by CpG-S motifs in vitro and in vivo. Eliminating 52 of the 134 CpG-N motifs present in a DNA vaccine markedly enhanced its Th1-like function in vivo, which was increased further by the addition of CpG-S motifs. Thus, depending on the CpG motif, prokaryotic DNA can be either immune-stimulatory or neutralizing. These results have important implications for understanding microbial pathogenesis and molecular evolution and for the clinical development of DNA vaccines and gene therapy vectors.

Figure 1

Induction of a Th2-like response by a CpG-N motif, and inhibition of the Th1-like response induced by a CpG-S motif. Anti-HBs antibody titers (IgG1 and IgG2a subclasses) in BALB/c mice 12 weeks after i.m. immunization with recombinant HBsAg, which was given alone (none) or with 10 μg stimulatory ODN (1826), 10 μg of neutralizing ODN (1631, CGCGCGCGCGCGCGCGCGCG; 1984, TCCATGCCGTTCCTGCCGTT; or 2010, GCGGCGGGCGGCGCGCGCCC; CpG dinucleotides are underlined for clarity) or with 10 μg stimulatory ODN + 10 μg neutralizing ODN. To improve nuclease resistance for these in vivo experiments, all ODN were phosphorothioate-modified. Each bar represents the group mean (n = 10 for none; n = 15 for 1826 and n = 5 for all other groups) for anti-HBs antibody titers as determined by end-point dilution ELISA assay. Solid portions of bars indicate antibodies of IgG1 subclass (Th2-like), and shaded portions indicate IgG2a subclass (Th1-like). The numbers above each bar indicate the IgG2a/IgG1 ratio in which a ratio >1 than indicates a predominantly Th1-like response and a ratio <1 indicates a predominantly Th2-like response (a value of 0 indicates a complete absence of IgG2a antibodies).

Figure 2

Enhancement of in vivo immune effects with optimized DNA vaccines. Mice were injected with 10 μg of pUK-S (solid bars), pMAS-S (open bars), pMCG16-S (lightly shaded bars), or pMCG50-S (darkly shaded bars) plasmid DNA bilaterally (50 μl at 0.1 mg/ml in saline) into the TA muscle as described (53). (A) The anti-HBs antibody response at 6 weeks (detected as described in Methods). Bars represent the group means (n = 5) for ELISA end-point dilution titers (performed in triplicate), and vertical lines represent the SEM. The numbers on the bars indicate the ratio of IgG2a/IgG1 antibodies at 4 weeks, as determined in separate assays (also in triplicate) by using pooled plasma. (B) CTL activity in specifically restimulated (5 days) splenocytes taken from mice 8 weeks after DNA immunization. Bars represent the group means (n = 3) for percentage of specific lysis (performed in triplicate) at an effector-to-target (E/T) ratio of 10:1; dots represent the individual values. Nonspecific lytic activity determined with non-antigen-presenting target cells, which never exceeds 10%, has been subtracted from values with HBsAg-expressing target cells to obtain percentage of specific lysis values.