Recent genetic transfer between Lactococcus lactis and enterobacteria

Abstract

The genome sequence of Lactococcus lactis revealed that the ycdB gene was recently exchanged between lactococci and enterobacteria. The present study of ycdB orthologs suggests that L. lactis was probably the gene donor and reveals three instances of gene transfer to enterobacteria. Analysis of ycdB gene transfer between two L. lactis subspecies, L. lactis subsp. lactis and L. lactis subsp. cremoris, indicates that the gene can be mobilized, possibly by conjugation.

FIG. 1.

Phylogenetic tree inferred from nucleotide sequences of the ycdB^Lac orthologous genes. Closely related species are indicated by the dashed ovals. The proximity of L. lactis and enterobacterial ycdB^Ent alleles is highlighted by the square shaded box. The data from the National Center for Biotechnology Information, Sanger Institute, and ERGO databases were used for streptococci, enteric bacteria, and L. lactis IL1403. Other sequences were determined in the course of this work. L. lactis subsp. hordniae data showing tight clustering to the L. lactis IL1403 group are not shown to avoid overcrowding of the figure. Str., Streptococcus. The scale bar indicates the expected number of nucleotide substitutions per site.

FIG. 2.

Genetic organization of the regions proximal to the ycdB (A and B) and yebC (C) genes in different bacteria. Alleles of conservative genome organization within the group of related species are indicated by black arrows. (A) Organization of the ycdB region in gram-positive lactobacilli. (B) Three different localizations of ycdB^Ent in enterobacteria. (C) Conservative genome organization of the region proximal to yebC (paralog of ycdB^Ent) in enterobacteria.

FIG. 3.

Presence of ycdB^Ent gene among enteric bacteria. The data are from reference , and the phylogenetic tree is redrawn from a figure in the article. The species possessing the gene are shown in bold type. The numbers indicate different occurrences of the horizontal transfer. Y. pestis, Yersinia pestis; K. pneumoniae, Klebsiella pneumoniae; ssp, subspecies; sv, serovar.

FIG. 4.

Neighbor-joining unrooted phylogenetic trees inferred from L. lactis comX, htrA, mutX, and ycdB^Lac gene nucleotide sequences. The strains used are listed in Table and were previously characterized by randomly amplified polymorphic DNA (19). The primers used to amplify the genes follow: for ycdB^Lac, ATGGGACGTAAATGGGCCAATATT and GAGATTTGCAACGTTATGATAAACTT; for comX, ACTTGCTGAAATCGTTGAAGG and GTTCGTCCTGAGCCAGGATC; for htrA, AGGTATTATTAAGTGAGAGTAG and GCACGACCAATTCCTGAATG; for mutX (IL1403), GGGACTCCCCAATAAGTATCATG and TATGCTGGGATTGCTCGTAAAGC; and for mutX (MG1363), GTGCTCCCCAATAGGTATCATGA and TATGCTGGGATTGCTCGTAAAGC. Multiple nucleotide sequences were analyzed by CLUSTAL (11). Multilocus comparison was performed by using CLUSTER analysis (6) and equality-weighted PAUP distance matrices. The results of phylogenetic and correlation analyses were visually presented by using the TREEVIEW program (16). The two strains that carry the L. lactis subsp. lactis ycdB^Lac gene but have all the other genes of the L. lactis subsp. cremoris type are indicated by the shaded arrows. The YcdB tree contains the L. lactis subsp. hordniae (“L. hordniae”) gene, which is closely related to the L. lactis subsp. lactis gene. The scale bar indicates the expected number of nucleotide substitutions per site.

FIG. 5.

(A) Long L. lactis subsp. lactis regions are present in the vicinity of the ycdB gene in strains QA5 and QA30, which belong to the L. lactis subsp. cremoris cluster. Mapping was performed by amplifying 5- to 10-kb regions, using primers deduced from the L. lactis IL1403 (4) or MG1363 (3) (GenBank accession no. BH770319 to BH771051) sequence and sequencing the resulting products. The genes were identified using CRITICA (1) and assigned to the IL1403 or MG1363 cluster. Levels of nucleotide identity of QA05 and QSA30 chromosome tags to L. lactis IL1403 are indicated by white circles and black triangles, respectively. (B) Nucleotide sequences in the transition zones between regions derived from L. lactis subsp. lactis and L. lactis subsp. cremoris in strains QA5 and QA30. The numbers refer to the coordinates in the IL1403 genome, the likely crossover sites are shown in bold type, and the conserved sequences at the left crossover sites are boxed.